ID: 1168704498

View in Genome Browser
Species Human (GRCh38)
Location 19:58461744-58461766
Sequence TGGGTGTCCCACCAGCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168704491_1168704498 26 Left 1168704491 19:58461695-58461717 CCTTTGGGAGATGGGCTGATCAC No data
Right 1168704498 19:58461744-58461766 TGGGTGTCCCACCAGCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168704498 Original CRISPR TGGGTGTCCCACCAGCATCA GGG Intergenic
No off target data available for this crispr