ID: 1168710533

View in Genome Browser
Species Human (GRCh38)
Location 19:58497623-58497645
Sequence ATATGCAAAGGGCTGTCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168710533_1168710540 -4 Left 1168710533 19:58497623-58497645 CCCACGGACAGCCCTTTGCATAT 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1168710540 19:58497642-58497664 ATATGGCGTTTACTGCTGTGGGG 0: 1
1: 0
2: 1
3: 17
4: 191
1168710533_1168710538 -6 Left 1168710533 19:58497623-58497645 CCCACGGACAGCCCTTTGCATAT 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1168710538 19:58497640-58497662 GCATATGGCGTTTACTGCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 64
1168710533_1168710539 -5 Left 1168710533 19:58497623-58497645 CCCACGGACAGCCCTTTGCATAT 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1168710539 19:58497641-58497663 CATATGGCGTTTACTGCTGTGGG 0: 1
1: 0
2: 1
3: 6
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168710533 Original CRISPR ATATGCAAAGGGCTGTCCGT GGG (reversed) Intronic
900710600 1:4111035-4111057 ATAGGCAAAGGGCTGTCCTGTGG + Intergenic
903682298 1:25105074-25105096 ATGTGCAAAGGTCTGTGGGTGGG - Intergenic
905645702 1:39623778-39623800 ATATGCAAAGTGCTGGAGGTGGG + Intergenic
916785506 1:168084291-168084313 TTATACAAAGGTCGGTCCGTGGG + Exonic
917474530 1:175357123-175357145 AAATGCAAAGCTCTGTCCATGGG - Intronic
918524209 1:185447287-185447309 ACATGCAAAGGGCTGTCCTGGGG + Intergenic
924603296 1:245510192-245510214 AGAGGCAAAGGGCTGTTTGTTGG + Intronic
1063116896 10:3078157-3078179 ATTTCCTTAGGGCTGTCCGTGGG - Intronic
1071346840 10:84701434-84701456 AAATGCAAAGGCCTGTCCCCAGG + Intergenic
1079360775 11:19768578-19768600 ATATCCAAAGGGCTGTCTTGAGG + Intronic
1082153321 11:48770737-48770759 ATCTGCAAAGGGATATCTGTGGG - Intergenic
1089054540 11:115574945-115574967 ATATATAAAGGGCTTTCCATAGG + Intergenic
1091375287 12:21183-21205 ATATCCAAAGGGCTGTCAGGTGG + Intergenic
1091614495 12:2039086-2039108 ATTTGCAAAGGGCTGTCTGTTGG - Intronic
1094232988 12:28129247-28129269 ATATGTAAAGGGCTTTCCCTGGG - Intergenic
1097195437 12:57240256-57240278 TTATGCAAAGCGCTCTCCGCCGG + Intronic
1101545747 12:105711056-105711078 ATATGCAAATGGCTGAAGGTGGG + Intergenic
1103469286 12:121167086-121167108 ATCTGCAAAGAGCTTTCCCTAGG + Intronic
1108547267 13:51508410-51508432 AAATGCAAAGGCCTTTCAGTAGG - Intergenic
1119612710 14:76077208-76077230 ATATGCACAGGGCTCTCCCAGGG + Intronic
1122043681 14:99008408-99008430 ATGTCCAAAGGGCTGCCCCTTGG + Intergenic
1124840155 15:33234081-33234103 AAATGCAAAAGGCTTTCAGTTGG + Intergenic
1130156499 15:81355033-81355055 AGTTGGAAAGGGCTGTCCATAGG - Intronic
1131961670 15:97795896-97795918 ATATGAAAAGTGCTGGCCCTTGG + Intergenic
1132395836 15:101473595-101473617 AGATGCAAAAGCCTGTCTGTGGG - Intronic
1132818901 16:1851278-1851300 ATAGGCACAGGGCTTTCCCTTGG + Intronic
1134133808 16:11667249-11667271 ATAGGCAAAGGCCTGGCGGTGGG + Intergenic
1137730157 16:50683786-50683808 ATCTGCAAAGGTCTGTCTCTGGG + Intergenic
1142275409 16:89116207-89116229 AGATCCAAAGGGCTGTTCGATGG - Intronic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1149731705 17:58952630-58952652 ATCTGCCAAGGGCAGCCCGTGGG + Intronic
1151482629 17:74379452-74379474 CCATGCCAAGGGCTGTCCCTTGG - Intergenic
1157158057 18:45287042-45287064 ATGTGCAAATGGCTCTCCTTTGG - Intronic
1160565088 18:79782047-79782069 AGATCCAAAGGGCTGTACGAAGG + Intergenic
1163362909 19:16859261-16859283 ACATGCAAAGGGCTGGCTTTGGG - Intronic
1163564395 19:18041619-18041641 ACCTGCATAGGGCTGTCTGTGGG - Intergenic
1168710533 19:58497623-58497645 ATATGCAAAGGGCTGTCCGTGGG - Intronic
930340772 2:50111713-50111735 ATATTCAAAGGGCTGTGATTTGG - Intronic
932173797 2:69580906-69580928 ATATGCATATGACTGTCCTTGGG - Intronic
933263985 2:80161303-80161325 ATAAGCTAAGGGCTGTGCATGGG - Intronic
939799506 2:146691131-146691153 ATTTGCAAAGAGCTGCCTGTGGG + Intergenic
943558859 2:189437245-189437267 ATATACAAATGGCTCTCAGTTGG - Intergenic
948291021 2:236824741-236824763 ATATGCAAAAGGCTGCTCTTTGG + Intergenic
1172518770 20:35554058-35554080 CTTTGCAAAGGGCTGTCCTAAGG - Intronic
1176163560 20:63661192-63661214 ATCTGCAAAGAGCTGCCCGCTGG + Intronic
1176247732 20:64105382-64105404 ATATGCCCACGGCTGTCTGTAGG + Intergenic
1176348867 21:5774148-5774170 ATATGGAAGGGGCTGTCTGGAGG - Intergenic
1176355681 21:5894732-5894754 ATATGGAAGGGGCTGTCTGGAGG - Intergenic
1176543188 21:8172218-8172240 ATATGGAAGGGGCTGTCTGGAGG - Intergenic
1176562139 21:8355263-8355285 ATATGGAAGGGGCTGTCTGGAGG - Intergenic
1177767543 21:25475439-25475461 ATATGCAAAGGCATGGTCGTGGG - Intergenic
1182653351 22:31869983-31870005 ATCTGCAGAGGGCAGGCCGTGGG + Intronic
1184884739 22:47335840-47335862 AAGTCCACAGGGCTGTCCGTGGG - Intergenic
1185251651 22:49805185-49805207 AAATGCAAAGTGCTGCCCTTGGG + Intronic
1203248059 22_KI270733v1_random:88456-88478 ATATGGAAGGGGCTGTCTGGAGG - Intergenic
959597918 3:108147851-108147873 ATATACAAAGGGCTGTGCCAGGG - Intergenic
962825927 3:139101040-139101062 ATGTGCAGAGGGCTGTCAGTGGG - Intronic
967962449 3:194936992-194937014 AGATGGAAAGGGCAGTCCTTTGG - Intergenic
968183223 3:196612615-196612637 GTATGGAAAGGGCTGTCCCAAGG - Intergenic
978712780 4:111805943-111805965 ATATACAAAAGGCTGTGGGTTGG - Intergenic
983346219 4:166527766-166527788 CTATGCAAAGGGTTGACCATGGG + Intergenic
997753170 5:136369615-136369637 ACATGCAAAGGATTGTCCCTTGG - Intronic
999150300 5:149422170-149422192 ATGTGCCAAGGGCTGTGCCTGGG - Intergenic
1001932048 5:175680168-175680190 ATGTGCACAAGGATGTCCGTTGG - Intronic
1002853626 6:1019021-1019043 AAACGCACAGGGCTCTCCGTGGG - Intergenic
1010737190 6:79456225-79456247 ATATGCACAGCTCTGTCCCTAGG - Intergenic
1015920780 6:138264500-138264522 AGATCCAAAGGGCTGACCCTGGG + Intronic
1017227453 6:152038376-152038398 GGATGCAAAGTGCTGTCCTTGGG - Intronic
1017483970 6:154885550-154885572 ATATGCAAAAGGCTATCCTTGGG - Intronic
1022767516 7:33430845-33430867 ATATGAAAAGAGTTGGCCGTAGG + Intronic
1023506666 7:40906645-40906667 ATATGCAAGAGGATGTGCGTAGG + Intergenic
1030299198 7:107958292-107958314 TTATTCAAAGGGTAGTCCGTGGG + Intronic
1034648753 7:152672670-152672692 ATATTCACAGGGCTATCCTTGGG + Intronic
1040639572 8:49317570-49317592 ATATCCAAAGGGTTGTGTGTGGG + Intergenic
1042876022 8:73440683-73440705 ATATGCAAAGGGTTGGCTTTGGG - Intronic
1045492536 8:102681065-102681087 AGATCCAAAGGGATGTCCATGGG + Intergenic
1045738979 8:105331914-105331936 ATTTGCAAAGGGATGTCCACTGG - Intronic
1048448133 8:134508155-134508177 ATATGCTAAGTCTTGTCCGTAGG + Intronic
1057190371 9:93083914-93083936 ACATGCAAAGGGCTGGAGGTGGG + Intronic
1203464459 Un_GL000220v1:71688-71710 ATATGGAAGGGGCTGTCTGGAGG - Intergenic
1192630197 X:72771549-72771571 ACATGCAAAGGTCTGTCTCTGGG - Intergenic
1192651513 X:72949255-72949277 ACATGCAAAGGTCTGTCTCTGGG + Intergenic
1198567252 X:137916967-137916989 ATTGGCAAAGAGCAGTCCGTGGG - Intergenic