ID: 1168713205

View in Genome Browser
Species Human (GRCh38)
Location 19:58513268-58513290
Sequence TCGGAGACCCACCTCAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168713199_1168713205 13 Left 1168713199 19:58513232-58513254 CCAGGAGTATGATGGGGCTTTCA No data
Right 1168713205 19:58513268-58513290 TCGGAGACCCACCTCAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168713205 Original CRISPR TCGGAGACCCACCTCAGATG TGG Intergenic
No off target data available for this crispr