ID: 1168713341

View in Genome Browser
Species Human (GRCh38)
Location 19:58513841-58513863
Sequence CCAGCCCGGCACCACCTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 2, 2: 0, 3: 30, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168713330_1168713341 11 Left 1168713330 19:58513807-58513829 CCAGTTCTCAGAAGTGGTCTAAC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1168713341 19:58513841-58513863 CCAGCCCGGCACCACCTGGAGGG 0: 1
1: 2
2: 0
3: 30
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168713341 Original CRISPR CCAGCCCGGCACCACCTGGA GGG Exonic
901026356 1:6280625-6280647 GCAGGCCAGGACCACCTGGAGGG + Intronic
901282330 1:8048308-8048330 CAAGCCCTGCTCCACCAGGAAGG + Intergenic
901493917 1:9610628-9610650 CCTGCCCGGCTCAACCTGAAGGG + Exonic
901684419 1:10935637-10935659 CCAAGCTGCCACCACCTGGAGGG - Intergenic
902040321 1:13487612-13487634 CCTGCCCGTCACCACCTGTCTGG + Intronic
902246233 1:15122622-15122644 CCTGCCCAGCCCCACCTGCAGGG - Intergenic
903761342 1:25700922-25700944 CCAGCCAGGCACCCCCCAGATGG + Intronic
914171204 1:145225556-145225578 CCAGCCCCCCACCCCCTGAAAGG + Intergenic
915315922 1:155029250-155029272 CTGGCCCGGCACCAGCTGCAGGG - Exonic
915549288 1:156623459-156623481 TCAGCCCGGCACCGTCTGCAGGG - Exonic
916218514 1:162419908-162419930 CCAGCCCCACACCACCCAGAGGG - Intergenic
917964233 1:180168316-180168338 CCAGACGGGCAGCACCTGGCAGG + Intronic
918342323 1:183578147-183578169 CCAGCCTGGCACAGCTTGGAGGG + Intronic
922583041 1:226712622-226712644 CTAGCCCTGCACTCCCTGGACGG + Intronic
922592243 1:226785958-226785980 CCTGCCCAGCCCCACATGGAAGG - Intergenic
922786960 1:228287615-228287637 CCAGCCCTCCACCACCTATAGGG + Intronic
924775110 1:247111147-247111169 CCAGCCCCACACCACCCGGCGGG - Exonic
1062844137 10:691003-691025 CCAGCCGGGACCCACCTGCACGG + Intergenic
1063204771 10:3820479-3820501 CCCGGCCGTCACCATCTGGAAGG - Intergenic
1066618077 10:37316135-37316157 CCAGCCCCACACCACCCGGCGGG + Intronic
1067044431 10:42976329-42976351 CCAGCCCCGCTCCTCCTGGCAGG + Intergenic
1067088536 10:43255124-43255146 CAAGCCCGACACCGGCTGGAGGG - Intronic
1067479155 10:46584231-46584253 CCAGCCCACCACCCCCAGGAAGG + Intronic
1067615584 10:47757570-47757592 CCAGCCCACCACCCCCAGGAAGG - Intergenic
1069486586 10:68827634-68827656 CGAGCCCGGCGCCAGCTGCACGG - Exonic
1069486673 10:68827970-68827992 CGAGCCCGGCGCCAGCTGCACGG - Intronic
1069734014 10:70639628-70639650 CCAGCCCCTCACCCCCTGGCAGG + Intergenic
1069830672 10:71280546-71280568 ACATCCCAGCACCACTTGGATGG - Intronic
1070776602 10:79113434-79113456 CCTGCCCGTCCACACCTGGAGGG + Intronic
1072189259 10:93066945-93066967 ACAGCCCGGACCCACCTGGATGG - Intronic
1073424773 10:103449772-103449794 CCGGCCCGGAACTACCTGTACGG - Exonic
1074293364 10:112158615-112158637 CCAACACTGCACCACCTGCAAGG + Intronic
1075207186 10:120457624-120457646 CCAGCCCCGCACCACCTGCCCGG + Intronic
1075716403 10:124558291-124558313 CCAGCCAGCCACCACCTAGTTGG + Intronic
1076385028 10:130049484-130049506 CCAGATCGCCTCCACCTGGAGGG + Intergenic
1076699049 10:132260751-132260773 CGTGCCCATCACCACCTGGAGGG + Intronic
1077159238 11:1105150-1105172 CCAGCTCGGGACAACCTCGAGGG + Intergenic
1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG + Intronic
1077343150 11:2034962-2034984 CCAGGCCGGAGCCAGCTGGAGGG - Intergenic
1079251399 11:18790647-18790669 CCAGCCCTGCCCCACTTGGAGGG - Intronic
1080908220 11:36568206-36568228 CCATCCCCTCATCACCTGGAAGG - Intronic
1083371411 11:62185249-62185271 CCAGCCCCACACCACCTGGCGGG + Intergenic
1084400924 11:68942452-68942474 CCTGCCCGGCACCCCCGGAAAGG - Intergenic
1084582166 11:70030823-70030845 CCACCCCTCCACCAGCTGGAAGG + Intergenic
1088976663 11:114822198-114822220 CCCGCTCGGCAGCACCTGGCTGG + Intergenic
1089137528 11:116261804-116261826 CCCCCCCGGCACCAGATGGAGGG - Intergenic
1089751070 11:120651589-120651611 CCAGCCCGGGTCCAACTTGAGGG - Intronic
1090264881 11:125347526-125347548 ACAGCCCTGCACCACCAGGTCGG - Intronic
1091194838 11:133721773-133721795 CCAGCCCTGTAACTCCTGGAAGG - Intergenic
1202826136 11_KI270721v1_random:90151-90173 CCAGGCCGGAGCCAGCTGGAGGG - Intergenic
1092480741 12:8857178-8857200 ACAGCCCTGCAGAACCTGGATGG + Exonic
1096184394 12:49568675-49568697 TCAGCCGGACCCCACCTGGACGG + Intronic
1096226449 12:49869546-49869568 CCAGGCCAGCCCCATCTGGAAGG - Exonic
1096412506 12:51387629-51387651 ACACCCCTGCCCCACCTGGAAGG - Intronic
1097699011 12:62801695-62801717 GCTGCCTGGCTCCACCTGGACGG - Intronic
1101955605 12:109209370-109209392 CCAGCCCCACCCCACCAGGATGG + Intronic
1103006001 12:117420851-117420873 CCAGCCCTGTACCAGCTGTAGGG - Intronic
1103624377 12:122206960-122206982 CCAGCCCAGGACCTCCTGGTGGG + Exonic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1104488131 12:129169436-129169458 CCAGCCTGGCTCCCCCTGCATGG + Intronic
1107016948 13:35715004-35715026 CCAGCCACACACCAGCTGGAGGG - Intergenic
1112078466 13:95938788-95938810 CCAATCCAGCAGCACCTGGATGG + Intronic
1114417868 14:22556411-22556433 CCAGCCCCCAAACACCTGGAGGG - Intergenic
1115646185 14:35369760-35369782 GCAGCCCGGCCGCACCTGCAGGG - Intergenic
1115889560 14:38011587-38011609 CCAGCCCCACACCACCCGGCAGG - Intronic
1116683800 14:48011747-48011769 CCAGCCCCACACCACCCGGCGGG - Intergenic
1117196711 14:53347249-53347271 CCAGCCCAGAACCACCTCTAGGG - Intergenic
1119548734 14:75492841-75492863 CCAGCCTGGCACCTCCTGGCTGG + Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122649856 14:103220464-103220486 CCGGCCCGGGACCACCTCGTGGG - Intergenic
1122906536 14:104804211-104804233 CCAACCCGGCACCCCGTAGATGG + Exonic
1125728562 15:41880479-41880501 CCCTCTTGGCACCACCTGGAGGG + Intronic
1126625942 15:50686230-50686252 CGAGCCCGGGACTACCTGGCTGG - Intronic
1126943463 15:53791622-53791644 CCAGCCCCACACCACCCGGCAGG + Intergenic
1127104129 15:55595197-55595219 CCAGCACTGCAGGACCTGGAAGG + Intergenic
1128252802 15:66174670-66174692 CCAGCCCAGCCCCACCTGTGGGG + Intronic
1130322610 15:82853511-82853533 CCTGCCCTGCCCGACCTGGAGGG - Intronic
1132466270 16:78689-78711 CCGGCCTGGCAGCACCCGGAGGG - Intronic
1132657040 16:1045752-1045774 GCAGACCGGGAGCACCTGGAGGG - Intergenic
1132700352 16:1219657-1219679 CCAGCTGGGCACCCCCAGGATGG - Intronic
1132855141 16:2041391-2041413 CCAGCTCTGCACCTCCTGGCTGG - Intronic
1132975473 16:2709192-2709214 CCAAGCCGGCACCCCGTGGATGG - Intergenic
1135132469 16:19864194-19864216 CCAGCCTGGCATCACATGCAGGG - Intronic
1136566361 16:31073114-31073136 CCAGCCAGGCAGCCCCTGGAGGG + Intronic
1141586438 16:85036751-85036773 CCAGCCCAGCACCCCCTGCCCGG + Intronic
1142142593 16:88479200-88479222 CCAGCCCAGCACCACCTGCGTGG - Intronic
1143532321 17:7512617-7512639 CCACCTCTGAACCACCTGGAGGG - Intronic
1146885059 17:36464927-36464949 GCAGCCAGGCAGCACCGGGAAGG - Intergenic
1147587831 17:41662821-41662843 CCAGCCCCGGACCACCGGCAGGG - Intergenic
1147647242 17:42041021-42041043 CCAGCCCGCCACCACCTTCCTGG - Intronic
1148462835 17:47848039-47848061 TCATCCGGGCACCAGCTGGATGG - Exonic
1148759586 17:49992704-49992726 CCCGCCTGTCAACACCTGGAGGG + Intronic
1148776340 17:50097543-50097565 CCAGCTCTGCACCAGCTGCACGG - Exonic
1150452501 17:65280482-65280504 CCATCCCAGCTCCACCAGGAAGG - Intergenic
1150676034 17:67246062-67246084 CCAGTCCGGGTCCACCTGGCGGG + Intergenic
1151255482 17:72873217-72873239 ACCGGCTGGCACCACCTGGATGG + Intronic
1151961058 17:77405849-77405871 CCAGCCCAGCCCCACATGGAGGG - Intronic
1151999722 17:77637651-77637673 GCAGCTCCGCCCCACCTGGAGGG - Intergenic
1152239517 17:79154131-79154153 CCAGTCCCGCCCCACCTGGCTGG + Intronic
1152251812 17:79216391-79216413 CCTGGCTGGGACCACCTGGAGGG + Intronic
1152703846 17:81833048-81833070 CCCGCCCGGCACCTGCAGGAGGG - Intronic
1152750603 17:82060814-82060836 CCAGCCCCTCACCCCCTGCAAGG + Intronic
1159100121 18:63949256-63949278 CCAGCCAGGCACCACCTAGCGGG - Intergenic
1160445210 18:78922249-78922271 CCAGACCTGCACCACGTGGAAGG - Intergenic
1160537735 18:79603983-79604005 CCCGCCTGGCACCTCCAGGATGG + Intergenic
1161014908 19:1978740-1978762 CCCGCCGCGCACCAGCTGGATGG - Exonic
1161041861 19:2114658-2114680 AGAGCCCGGCCCCACCCGGAAGG + Intronic
1162743542 19:12786615-12786637 CCAGGCCGGCCCCACGAGGAGGG - Intronic
1165213857 19:34255075-34255097 CCCGCCCGGCAGCCCCGGGATGG - Intronic
1165832845 19:38737661-38737683 CCTGCCCGGCCCCACCTCGAGGG + Intronic
1168113726 19:54209272-54209294 CCAGCCCGCCAGCGCCTAGATGG - Intronic
1168713341 19:58513841-58513863 CCAGCCCGGCACCACCTGGAGGG + Exonic
924999548 2:394048-394070 TCTGCCCAGCACCTCCTGGAGGG - Intergenic
926710135 2:15872699-15872721 CCAGCCCGCCTCCACCAGGATGG - Intergenic
927494908 2:23545801-23545823 CCAACCTGGCACCATCAGGATGG - Intronic
929053968 2:37860127-37860149 CCAGCCTGGGAGCTCCTGGAGGG + Intergenic
930370325 2:50493372-50493394 CCAAGCTGGGACCACCTGGAAGG - Intronic
932265734 2:70365633-70365655 CCTGCCTCTCACCACCTGGAGGG + Intergenic
934649899 2:96084808-96084830 CCAGCCCAGCAGCCCCTGGCTGG - Intergenic
934877286 2:97936060-97936082 CCAGTGAGGCCCCACCTGGAAGG + Intronic
934879745 2:97965474-97965496 CCAGCCCCACACCACCTGGCGGG - Intronic
936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG + Intergenic
936197736 2:110384821-110384843 CCAGCCCAGCACCACCTGGAAGG - Intergenic
938300413 2:130207343-130207365 CTAACCCAGCACCACCTCGAGGG - Intergenic
938456315 2:131467134-131467156 CTAACCCAGCACCACCTCGAGGG + Intronic
938874943 2:135522437-135522459 CCAGCCCCACACCACCCGGCGGG - Intronic
941972394 2:171365584-171365606 CCAGCCCCATACCACCTGGCGGG - Intronic
947519325 2:230831771-230831793 CCATCCCTGCACCAGATGGAGGG + Intergenic
947745770 2:232506594-232506616 CCAGCCTGGCCCTCCCTGGAGGG - Intergenic
947860263 2:233353471-233353493 CAAGCCCTGCTCCACCTGGATGG + Intergenic
948040356 2:234896660-234896682 CCAGGCCAGGATCACCTGGACGG + Intergenic
948622360 2:239244387-239244409 CAAGACCTGCACCTCCTGGAGGG + Intronic
1169019099 20:2315449-2315471 ACAGCCCAGGACCTCCTGGAAGG + Intronic
1169091352 20:2863079-2863101 CCTGTCCAGCAGCACCTGGATGG - Exonic
1170557954 20:17530889-17530911 CCAGCCCCGCGCCGCCGGGACGG + Intronic
1170608901 20:17895495-17895517 CCTGCCCACCCCCACCTGGAAGG + Intergenic
1171974776 20:31587654-31587676 GCCGCCCGGCACCACTAGGACGG - Intergenic
1172666614 20:36604950-36604972 TGAGCCTGGCACCACCTGGAGGG + Intronic
1174619690 20:51864604-51864626 CCACCCAGGCTCTACCTGGAAGG + Intergenic
1175100529 20:56575793-56575815 GCAGCCAGGCACCAGGTGGAAGG - Intergenic
1175996165 20:62813186-62813208 CCAGCCCAGCAGGACCTGCAGGG + Exonic
1175996205 20:62813306-62813328 CCCGCCCGGCAGGACCTGCAGGG + Exonic
1175996225 20:62813366-62813388 CCAGCCCGGCAGGACCTACAAGG + Exonic
1175996245 20:62813426-62813448 CCCGCCCGGCAGGACCTGCAGGG + Exonic
1175996266 20:62813486-62813508 CCCGCCCGGCAGGACCTGCAGGG + Exonic
1175996286 20:62813546-62813568 CCAGCCCGGCAGGACCTACAAGG + Exonic
1177088968 21:16742256-16742278 CCAGCCAGGAACTCCCTGGAAGG + Intergenic
1177296309 21:19180985-19181007 GCAGCCCCACACCACCTGGTGGG + Intergenic
1179657697 21:42855372-42855394 CCACCCCTGCCCCACCTGGCTGG + Intronic
1180594870 22:16966540-16966562 CCAGCCAGGAACCCCATGGATGG + Intronic
1180701043 22:17781586-17781608 CCAGCCAGGCACCACCAGCCAGG - Intergenic
1180854468 22:19037445-19037467 CCAGCGGGGCAGCACCTGGGAGG - Exonic
1180951624 22:19723067-19723089 ACAGCCCGGCCCGACCTGGAGGG + Exonic
1181510780 22:23387920-23387942 GCAGCCCGGCTCCAGCAGGAAGG + Intergenic
1181756127 22:25026301-25026323 CCAGCCAGCCCCCACCTAGATGG - Intronic
1184373387 22:44096969-44096991 ACCCCCCGGCACCCCCTGGATGG + Intronic
1185061737 22:48610555-48610577 GCAGCTCGGGACCACCAGGAGGG + Intronic
1185061754 22:48610619-48610641 GCAGCTCGGGACCACCTGGAGGG + Intronic
1185158776 22:49210043-49210065 ACAGCCGGGCAGCCCCTGGAGGG + Intergenic
954094514 3:48314514-48314536 GCAGCCTGGCAGCATCTGGAGGG + Intronic
954681158 3:52346763-52346785 CCCGCCGGGCCCCACCTGTAGGG - Exonic
954715334 3:52524010-52524032 CCAACCCAGCCCTACCTGGAAGG - Exonic
955489638 3:59469503-59469525 CCAGCCCCACACCACGTGGTGGG + Intergenic
955768973 3:62371384-62371406 CCACCTCGGGAACACCTGGAAGG + Intronic
961825215 3:129595707-129595729 CCAGCTGGACACCATCTGGAAGG + Intronic
962603342 3:137011667-137011689 ACAGCCCTTCACCACCTGGAGGG + Intergenic
964040871 3:152260324-152260346 CCCTCCTGGCCCCACCTGGATGG - Intronic
968477948 4:821162-821184 CCAGCCAGGCCCAACCTGGGGGG - Intronic
968637959 4:1692123-1692145 CCAGCCCAGCATCACTTGGAGGG + Intergenic
968656195 4:1779482-1779504 CCATCCCCTGACCACCTGGATGG + Intergenic
969530101 4:7725820-7725842 ACAGCCCAGCACCACCAGGCAGG + Intronic
970918008 4:21358162-21358184 CCAGCCCCCCACCACCTGACAGG - Intronic
972420125 4:38879130-38879152 CCTGCCCGGCCCCACATGGCTGG - Intronic
972665378 4:41160191-41160213 CCAGGCCGGCAGCACCTGTGAGG - Intronic
976306538 4:83565680-83565702 CCAGCCCCACACCACCCGGTGGG + Intronic
979016922 4:115446783-115446805 CCAGCCCCCCACCACCTGACAGG + Intergenic
979649813 4:123115602-123115624 TCAGCCCGGCCCCACCTGAGTGG + Intronic
979660105 4:123243590-123243612 CCAGCCCCCCACCACCTGACAGG - Intronic
980153924 4:129081421-129081443 CCAGCCCCACACCACCTGGCAGG - Intronic
980730066 4:136812598-136812620 CAAGCCCGGCTCCACCTTGGGGG + Intergenic
983247557 4:165305704-165305726 CCTGCCCTGCACCTCCTGGAAGG - Exonic
988413893 5:30921001-30921023 CTAGCCTGGCACCTCCTGGCAGG - Intergenic
992343604 5:75852157-75852179 CCAGCCCCCCACCACCTGACAGG - Intergenic
992344243 5:75860076-75860098 CCAGCCCCACACCACCTGGTGGG - Intergenic
996763993 5:127017107-127017129 CCAGCCCCCCACCACCTGACAGG - Intronic
999978585 5:156936964-156936986 CCAGTCCTGTACCACCTGGATGG + Intronic
1001762507 5:174220079-174220101 TCAGCCAGGAACCACCAGGATGG + Intronic
1002460327 5:179370098-179370120 TCAGCTTGGCACCAGCTGGACGG + Intergenic
1004509956 6:16277358-16277380 CCTGGCCGGCACCACCTTGTAGG - Intronic
1005861615 6:29906780-29906802 CAAGCCCTGTGCCACCTGGAAGG - Intergenic
1006401850 6:33822346-33822368 GCAGCCCAGCACCTCCGGGAAGG - Intergenic
1007243377 6:40442826-40442848 CCAGCTCCGCACAACCAGGAGGG - Intronic
1007412278 6:41671879-41671901 CCATCCCGCCAACACCTGGCAGG + Intergenic
1007762000 6:44138753-44138775 CCTGCCCTGCCCCACCTTGAGGG + Intronic
1008222597 6:48874224-48874246 CCAGCCCCACACCACCCGGTGGG - Intergenic
1013975812 6:116077359-116077381 CCAGCCCTTCCCCACCTTGATGG + Intergenic
1014845889 6:126276524-126276546 CCAGCCCTGCTCCTCCTTGAGGG + Intergenic
1016801707 6:148175314-148175336 CCATGCCGGCACCATATGGAGGG - Intergenic
1017718505 6:157228695-157228717 CCAGCCCAGCACCAACTGCCCGG + Intergenic
1017893029 6:158654855-158654877 ACACCACAGCACCACCTGGAAGG - Intronic
1018181429 6:161226774-161226796 CCTGCCCGGCAGCACAGGGAAGG - Intronic
1019147200 6:169983094-169983116 CCTGCCCAGCCCCTCCTGGAAGG + Intergenic
1019412436 7:912145-912167 CCTGCCTGGTACCACCAGGAGGG + Intronic
1019628406 7:2033137-2033159 CCAGCCAGGCACCACGTGCCAGG + Intronic
1023508865 7:40929081-40929103 CCAGCCCGCCACCCCCTGACAGG + Intergenic
1024330144 7:48147265-48147287 CCAGCCCCACACCACCCGGTGGG + Intergenic
1024335300 7:48200932-48200954 CCAGCCCCACACCACCTGGCAGG + Intronic
1026907026 7:74068649-74068671 CCAGGCAGGCCCCACCTGGACGG - Exonic
1032057814 7:128697644-128697666 GCAGCCCGGGACCTCCTGGTGGG + Intergenic
1034839128 7:154379351-154379373 CCAGCCCCCCACCACCTGACAGG - Intronic
1034940230 7:155225855-155225877 CAGGCCTGGCACCACCTGGTAGG + Intergenic
1035904217 8:3491830-3491852 CCAGCCCCACACCACCCGGCGGG + Intronic
1037813096 8:22098170-22098192 CCTGCCAGGCCCCAGCTGGACGG + Exonic
1039831522 8:41219048-41219070 CCATCATGGCACCAGCTGGAGGG + Intergenic
1040059421 8:43091944-43091966 CCAGCCCCACACCACCCGGCGGG + Intergenic
1040328913 8:46376083-46376105 CCAGCCCGGGACCACCCAGGGGG - Intergenic
1040787066 8:51178604-51178626 CCAGCCCCACACCACCCAGAGGG + Intergenic
1041915766 8:63137222-63137244 CCAGCCCCGCACCACCTGACAGG - Intergenic
1042721204 8:71828415-71828437 GCAGCCCGGCTCCTCCAGGATGG - Intronic
1046115610 8:109779823-109779845 CCAGCCAAGCATCACCTTGATGG - Intergenic
1049059056 8:140261875-140261897 CCTGCCCAACACAACCTGGAAGG + Intronic
1049321372 8:141998676-141998698 CCAGCCAGGCCCCACCCAGAGGG - Intergenic
1049445326 8:142627835-142627857 CCAGCCCGGGAGCACCTTGAGGG + Intergenic
1049479746 8:142816237-142816259 CCAGCCAGGCAACACCCGCAAGG + Intergenic
1049538104 8:143191883-143191905 CCAGCTCAGAGCCACCTGGAAGG - Intergenic
1052835996 9:33250531-33250553 TGTGCCAGGCACCACCTGGAAGG + Intronic
1053410781 9:37914823-37914845 GCAGCCCAGGTCCACCTGGAAGG - Intronic
1054890540 9:70246309-70246331 CCAGCCCCCCACCCCCTGGCAGG - Intergenic
1055611914 9:78032045-78032067 GCCGCCCGGCCCCTCCTGGAAGG + Intergenic
1056578845 9:87876011-87876033 CCACCCAGGCAGGACCTGGACGG + Intergenic
1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG + Intronic
1058285315 9:103169755-103169777 CCAGTGAGGCACCAGCTGGATGG - Intergenic
1059406142 9:114099100-114099122 CCACCTGAGCACCACCTGGATGG + Intronic
1059426316 9:114223042-114223064 CGAGGCCTACACCACCTGGATGG - Intronic
1059959744 9:119553325-119553347 CCAGCAGGTCACCACCTGGGTGG + Intergenic
1060420719 9:123467772-123467794 CCAGGCTGGCCCCACCTGCATGG - Intronic
1060962508 9:127690954-127690976 CCAGCCCTGCACGCCCTGGCTGG + Exonic
1061090667 9:128424265-128424287 CCATCCCGGCCTCACCTGGGGGG - Exonic
1062051240 9:134448120-134448142 CCAGGCCAGCACCACCAGCAGGG - Intergenic
1062215088 9:135384692-135384714 CCAGCCCCTCCCCACCTGAAGGG + Intergenic
1062458775 9:136654194-136654216 CCAGCCCACCACCCCCGGGAGGG + Intergenic
1062582695 9:137235516-137235538 CAAGTCCGGCAGCCCCTGGAGGG + Intronic
1062717316 9:138017765-138017787 CCAGCCAGTCACTCCCTGGAGGG - Intronic
1203776412 EBV:75618-75640 CCACCCCGGCGCCACCTGCAGGG + Intergenic
1190321900 X:49184659-49184681 CCAGCCCTGCAACTCCTGTAGGG - Exonic
1195988882 X:110662881-110662903 CCAGCCCCCCACCACCTGACAGG - Intergenic
1200873327 Y:8126195-8126217 CCAGCCCTACACCACCCGGCAGG + Intergenic
1200873447 Y:8127327-8127349 CCAGCCCCACACCACCTGGCAGG - Intergenic