ID: 1168713402

View in Genome Browser
Species Human (GRCh38)
Location 19:58514071-58514093
Sequence GCTGCTGGAGCGCCACCTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 322}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168713402_1168713407 8 Left 1168713402 19:58514071-58514093 CCGCCAGGTGGCGCTCCAGCAGC 0: 1
1: 0
2: 1
3: 34
4: 322
Right 1168713407 19:58514102-58514124 CGAGAAGACCTTGCCGCAGGCGG 0: 1
1: 0
2: 1
3: 7
4: 55
1168713402_1168713410 14 Left 1168713402 19:58514071-58514093 CCGCCAGGTGGCGCTCCAGCAGC 0: 1
1: 0
2: 1
3: 34
4: 322
Right 1168713410 19:58514108-58514130 GACCTTGCCGCAGGCGGGGCAGG 0: 1
1: 1
2: 1
3: 20
4: 141
1168713402_1168713411 15 Left 1168713402 19:58514071-58514093 CCGCCAGGTGGCGCTCCAGCAGC 0: 1
1: 0
2: 1
3: 34
4: 322
Right 1168713411 19:58514109-58514131 ACCTTGCCGCAGGCGGGGCAGGG 0: 1
1: 0
2: 2
3: 13
4: 141
1168713402_1168713409 10 Left 1168713402 19:58514071-58514093 CCGCCAGGTGGCGCTCCAGCAGC 0: 1
1: 0
2: 1
3: 34
4: 322
Right 1168713409 19:58514104-58514126 AGAAGACCTTGCCGCAGGCGGGG 0: 1
1: 0
2: 1
3: 7
4: 109
1168713402_1168713414 26 Left 1168713402 19:58514071-58514093 CCGCCAGGTGGCGCTCCAGCAGC 0: 1
1: 0
2: 1
3: 34
4: 322
Right 1168713414 19:58514120-58514142 GGCGGGGCAGGGCGCGCGCTCGG 0: 1
1: 3
2: 4
3: 67
4: 525
1168713402_1168713406 5 Left 1168713402 19:58514071-58514093 CCGCCAGGTGGCGCTCCAGCAGC 0: 1
1: 0
2: 1
3: 34
4: 322
Right 1168713406 19:58514099-58514121 GTGCGAGAAGACCTTGCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 40
1168713402_1168713408 9 Left 1168713402 19:58514071-58514093 CCGCCAGGTGGCGCTCCAGCAGC 0: 1
1: 0
2: 1
3: 34
4: 322
Right 1168713408 19:58514103-58514125 GAGAAGACCTTGCCGCAGGCGGG 0: 1
1: 0
2: 4
3: 69
4: 157
1168713402_1168713415 27 Left 1168713402 19:58514071-58514093 CCGCCAGGTGGCGCTCCAGCAGC 0: 1
1: 0
2: 1
3: 34
4: 322
Right 1168713415 19:58514121-58514143 GCGGGGCAGGGCGCGCGCTCGGG 0: 1
1: 1
2: 5
3: 48
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168713402 Original CRISPR GCTGCTGGAGCGCCACCTGG CGG (reversed) Exonic
900245139 1:1633080-1633102 GCTGCTCGGGGGCCACCTCGCGG - Exonic
900256370 1:1700239-1700261 GCTGCTCGGGGGCCACCTCGCGG - Intronic
900331996 1:2139919-2139941 GCTGCTGGAGAGCCCTCTGCTGG + Intronic
900554216 1:3271696-3271718 TCAGCTGGAGGGGCACCTGGTGG + Intronic
900965213 1:5952714-5952736 GCTGCTGGAGCTCCACGTCCAGG - Exonic
900980152 1:6041628-6041650 TCTGCAGCAGCGCCACCCGGTGG - Intronic
901613121 1:10515068-10515090 GCTGCTGGAGAGCCCGCTGGAGG - Intronic
901820118 1:11823579-11823601 GCAGCGTGAGCGTCACCTGGAGG - Intronic
902174878 1:14641547-14641569 ACAGCTGGAGCACCACCTTGAGG - Intronic
903830155 1:26169813-26169835 GCGGCTCGAGCGCCGCCAGGCGG - Intergenic
904811411 1:33165479-33165501 GCTGCTCAAGCGACAACTGGCGG - Exonic
905876079 1:41432888-41432910 GCTGCTGCAGCGCCCCCTGCTGG + Intergenic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906345230 1:45010637-45010659 GCTGCTGGTGTGCCGCCCGGCGG - Exonic
907298310 1:53469688-53469710 GCTGCTGGAGGCCTGCCTGGAGG - Intergenic
907489686 1:54800983-54801005 GCGGCAGGAGCTCCAGCTGGCGG - Exonic
911134987 1:94429833-94429855 CCTGCTGGGGCACCACCTAGTGG + Intronic
911246621 1:95525316-95525338 CCTGCTGGAGCTGAACCTGGTGG - Intergenic
911855685 1:102872290-102872312 CCTGCTGGGGCACCACCTAGTGG - Intergenic
911907427 1:103588180-103588202 CCTGCTGGGGCACCACCTAGTGG - Intergenic
912758247 1:112342712-112342734 GCTGCTGGTGCTCCAGCTGTCGG + Intergenic
913307819 1:117450956-117450978 CCTGCTGGGGCACCACCTAGTGG + Intronic
914912988 1:151801792-151801814 GCTCCTGGAGCCGCACCAGGGGG + Exonic
914950807 1:152111773-152111795 GCAGCTGAAGCGCGACCAGGAGG - Exonic
915164765 1:153942333-153942355 GCTGCTGGGCCGCTACCCGGAGG - Exonic
917478240 1:175387105-175387127 GGTGCTGGAGCCACAGCTGGTGG - Intronic
918215632 1:182390754-182390776 GCAGCTGGAGCGCGACCCGGAGG + Exonic
918718114 1:187817975-187817997 TCTGCTGGGGCACCACCTAGTGG - Intergenic
920032917 1:203048265-203048287 GCAGCTGGAGGGACAGCTGGAGG + Intronic
920145972 1:203861434-203861456 GGTCCTACAGCGCCACCTGGAGG - Intergenic
920381347 1:205536309-205536331 GCTGCTCTACCACCACCTGGGGG - Intergenic
922161455 1:223081577-223081599 GGTCCTGCAGCACCACCTGGGGG + Intergenic
922674605 1:227542697-227542719 CCTGCGGGCGCGCCCCCTGGTGG + Intergenic
1062760090 10:11459-11481 ACCGCTGGCGCGCCCCCTGGTGG - Intergenic
1063335599 10:5210434-5210456 CCTGCTGGGGCACCACCTAGTGG - Intronic
1064466280 10:15585430-15585452 GCCGCTGGGGCGCCCCCTAGCGG - Intronic
1066745979 10:38604468-38604490 GCGGCTGGAGCAGCAGCTGGCGG + Intergenic
1067206131 10:44215482-44215504 GCTACAGGAGCACCACCTAGGGG + Intergenic
1070919101 10:80172815-80172837 GCTGGTGGGTAGCCACCTGGGGG + Exonic
1071086868 10:81875368-81875390 GCTGCCGAAGCGGCACCAGGTGG - Exonic
1072123038 10:92420658-92420680 GCGGCTGGAGCGCGAGCTCGGGG + Intergenic
1072409064 10:95183852-95183874 GCGGTGGGAGCGCCGCCTGGAGG - Intergenic
1073266177 10:102229932-102229954 GGTGCTGCGGCGCCACCTCGTGG - Intergenic
1073379853 10:103069785-103069807 GATGCTGGGGTGCCACCTTGTGG + Intronic
1073401353 10:103260120-103260142 CCTGCTGGAGCACCACCTAGTGG + Intergenic
1073431574 10:103490860-103490882 GGTGCTGGAGCATCACCTTGTGG + Intergenic
1074405980 10:113180794-113180816 GCTGCTGGAGTCCCATCGGGGGG + Intergenic
1074429475 10:113381565-113381587 GCTGATGCAGCTCCACGTGGAGG - Intergenic
1074536078 10:114329445-114329467 GCTGGTGGGTCCCCACCTGGTGG - Intronic
1074777687 10:116778343-116778365 GCTGTTAGAGCACCAGCTGGAGG - Intergenic
1075081305 10:119385712-119385734 GCTGCAGGAGGGTCACCTTGTGG + Intronic
1075194645 10:120345287-120345309 GATGCTGAAGAGCCACCTGGAGG + Intergenic
1077049142 11:558928-558950 GCTGCAGGTGCGCCTGCTGGAGG + Exonic
1077058755 11:608617-608639 GCTGCTGGAGCGGTCACTGGAGG - Exonic
1077228837 11:1449769-1449791 GCTGATGGACCGAGACCTGGAGG - Exonic
1077297175 11:1831734-1831756 GCTGCAGGAACCCCACCTTGTGG - Intronic
1079626693 11:22625282-22625304 GCTGCTGGAGCGTCTGCAGGAGG - Exonic
1080109961 11:28555537-28555559 GTGGCTGGAGCTCCAGCTGGAGG + Intergenic
1081569511 11:44280869-44280891 TCTGCTGGAACTCCCCCTGGGGG + Intronic
1081621434 11:44621310-44621332 GAGGCTGCAGCGCCGCCTGGTGG - Intergenic
1081867890 11:46369615-46369637 GCCTCTGGAGTGCCACCAGGGGG + Intronic
1082748480 11:56993882-56993904 TCTACTGGAGCACCACCTAGTGG - Intergenic
1083514461 11:63243589-63243611 GCTGCTGGAGTGGGAACTGGTGG + Intronic
1083678578 11:64341102-64341124 GCAGCTGCAGCTCCTCCTGGAGG - Exonic
1084208443 11:67609536-67609558 GCTGCTGGAAGGCTGCCTGGTGG + Exonic
1084219815 11:67671013-67671035 GCTGCTTGAGCGCCGGGTGGAGG - Intronic
1084274853 11:68046043-68046065 GCAGCTAGAGCATCACCTGGAGG + Intronic
1085058705 11:73424886-73424908 ACTGCTGCTGAGCCACCTGGGGG + Intronic
1085455100 11:76661154-76661176 CCTGCTGGAGCGGCTGCTGGGGG - Exonic
1091330472 11:134727843-134727865 GCTCCTGAAGCAGCACCTGGGGG - Intergenic
1091786186 12:3244644-3244666 GCTGGGGGATCGCCATCTGGTGG - Intronic
1092488044 12:8919800-8919822 GCTGCTGGAGCATGAACTGGTGG - Exonic
1092489510 12:8932717-8932739 GCTGCTGCTGCGCCAACTGGAGG - Exonic
1093706115 12:22276496-22276518 GCTCCTGGAGGGCTGCCTGGGGG + Intronic
1095441972 12:42246647-42246669 GCTGCTGGAGCGATGCTTGGAGG + Intronic
1096156124 12:49342417-49342439 GCGGCAGGAGCGCCTCCTGCGGG + Intergenic
1096157304 12:49347764-49347786 TCGGCGGCAGCGCCACCTGGCGG + Exonic
1096946425 12:55413455-55413477 GCTGCTGCTGCGCCAACTGGAGG + Intergenic
1096946645 12:55414607-55414629 GCTGCTGGAGCATGAACTGGTGG + Intergenic
1097357789 12:58621192-58621214 GCTTGTGGAGCCCCACCTTGGGG + Intronic
1097570497 12:61325955-61325977 CCTGCTGGGGCACCACCTAGTGG - Intergenic
1099668477 12:85660280-85660302 CCTTCTGGGGCACCACCTGGTGG + Intergenic
1101866389 12:108523515-108523537 GCTGCTGGGGCGGCAACTGCAGG + Exonic
1103610849 12:122123365-122123387 GTTTCTTGAGCGCCACCTGTTGG + Intronic
1106092158 13:26606050-26606072 GCTGGTGGGGCGGCACCTGGTGG + Intronic
1106786163 13:33109988-33110010 GCTGAGAGAGCGCCACCTGTGGG - Exonic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1114604847 14:23988437-23988459 GCTGCTCCAGCCTCACCTGGTGG + Intronic
1114610293 14:24035984-24036006 GCTGCTCCAGCCTCACCTGGTGG + Intergenic
1114658786 14:24331856-24331878 GCTGATGGAGCGCGCCCTGCGGG - Exonic
1114672171 14:24417137-24417159 GCTGCTGGAGCTCCACTGGAGGG + Exonic
1115761032 14:36579854-36579876 GCTGAGGGAGGGCCGCCTGGGGG - Intergenic
1117394822 14:55298688-55298710 GCCGCTGGATGGCCTCCTGGAGG - Intronic
1118281168 14:64430177-64430199 CCTCCTGCAGCGCCACCTAGGGG - Exonic
1118620609 14:67611009-67611031 GCTGCTGGAGCCGTACCTGATGG + Intergenic
1119323877 14:73747104-73747126 TGTGCTGGAGGGCCAGCTGGAGG - Intronic
1122179853 14:99947046-99947068 ACTGCAGGTGCGCCACCTGGTGG + Intergenic
1122603439 14:102932497-102932519 TCTGCTGGATGGGCACCTGGGGG - Exonic
1122776714 14:104120105-104120127 GCTGCTGGAGGGCCACGCCGGGG + Intergenic
1122891415 14:104733851-104733873 TCTCCTTGAGCTCCACCTGGAGG - Intronic
1125328907 15:38564188-38564210 GCTCCGGCTGCGCCACCTGGTGG - Intronic
1125422787 15:39521340-39521362 GCTCCTGGACCGCTTCCTGGAGG + Intergenic
1125513915 15:40307545-40307567 GCTGCTGGAGCACCAGGTGGTGG - Intronic
1125724334 15:41860695-41860717 GATGCTGGAGTGGGACCTGGAGG - Exonic
1126266146 15:46756118-46756140 GCTACTGGGGCAGCACCTGGTGG - Intergenic
1127961029 15:63891164-63891186 GCCCTTGCAGCGCCACCTGGTGG + Intergenic
1127976448 15:64000732-64000754 GGTGCTGGAGAGCCACATGAGGG + Intronic
1129672485 15:77614949-77614971 GCTGCAGGAGATCCAGCTGGTGG - Exonic
1129853771 15:78810600-78810622 GCTGCTGGCGCGGCCCCTGGCGG - Intronic
1132157351 15:99504922-99504944 CCTCCTGGAGCTCCTCCTGGAGG + Intergenic
1132331387 15:101014524-101014546 GCTGCTGAGCCGCCAGCTGGGGG + Intronic
1132873031 16:2124034-2124056 GCTGCTGGGGCACCACTGGGTGG + Intronic
1132915190 16:2340341-2340363 GCTGAGGGAGCGGCACCTGCAGG + Intronic
1134031771 16:10997934-10997956 GCTGCTGTACCCACACCTGGTGG + Intronic
1134069977 16:11255010-11255032 GCTGCTGGAGCACTACGTGGCGG - Exonic
1134552119 16:15143213-15143235 GCTGCTGGGGCACCACTGGGTGG + Intergenic
1135485925 16:22864559-22864581 GCTGCAGGGGCCCCTCCTGGGGG + Intronic
1136117776 16:28106120-28106142 GCTCCTGGACCACCACCTGCAGG + Exonic
1136737083 16:32475176-32475198 GCGGCTGGAGCAGCAGCTGGTGG - Intergenic
1137873296 16:51971340-51971362 TCTGCTTCAGCGCCATCTGGAGG + Intergenic
1138147780 16:54627745-54627767 CCTGCTGGAACGCCCCATGGTGG + Intergenic
1139530520 16:67540308-67540330 TCTGCTGGAGAGCGAGCTGGAGG + Exonic
1139606458 16:68022488-68022510 CCTGCTGGTGCGGGACCTGGAGG - Exonic
1140205182 16:72927683-72927705 GCTGCTGCAGCTCCCCCGGGCGG - Intronic
1141136733 16:81470531-81470553 GCTGCTGACAGGCCACCTGGAGG + Intronic
1142132541 16:88437520-88437542 CAAGCTGCAGCGCCACCTGGCGG + Exonic
1142183314 16:88682120-88682142 GCTGCTGCATGGGCACCTGGAGG - Intronic
1142186860 16:88698810-88698832 GCTGCCCGAGCAGCACCTGGCGG - Intronic
1142432333 16:90036493-90036515 GCTGATGCAGCGCCACGAGGAGG + Exonic
1203015988 16_KI270728v1_random:354401-354423 GCGGCTGGAGCAGCAGCTGGCGG + Intergenic
1203034323 16_KI270728v1_random:627559-627581 GCGGCTGGAGCAGCAGCTGGCGG + Intergenic
1142699119 17:1649014-1649036 GCAGCTGCAGCGCCTCCTGCTGG - Exonic
1143368804 17:6425675-6425697 GCTGCTGGAGAACCGCATGGCGG - Exonic
1143408772 17:6696194-6696216 GCTGCTCCAGGGTCACCTGGGGG + Intronic
1143951914 17:10639381-10639403 CCTGCTGGTGCGCCTCTTGGAGG + Exonic
1144608709 17:16690006-16690028 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1144608718 17:16690054-16690076 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1144608727 17:16690102-16690124 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1144819096 17:18058978-18059000 GAGTCTGGAGGGCCACCTGGTGG - Intronic
1144904089 17:18625725-18625747 GGAGCTGCAGCGCCACCTGCAGG - Intergenic
1145128484 17:20320921-20320943 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1145128492 17:20320969-20320991 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1146061078 17:29607735-29607757 GCTGCTCGATGTCCACCTGGAGG - Exonic
1146098394 17:29954671-29954693 CCTGCTGGGGCACCACCTAGTGG + Intronic
1146408768 17:32564150-32564172 GGTGCTGGAGCCCTGCCTGGGGG + Intronic
1146793131 17:35764230-35764252 GCCGCAGCAGCGCCACCTGCTGG - Exonic
1148336047 17:46841982-46842004 TCTGCAGGAGCGCCCCCTGCCGG - Intronic
1148437495 17:47694941-47694963 GCTCCTGCAGCCCGACCTGGGGG + Intronic
1148497393 17:48061118-48061140 GCTCCTGGAGGGCTGCCTGGGGG + Exonic
1149656692 17:58313046-58313068 GCAGCTTGAGTGTCACCTGGTGG - Intronic
1150249115 17:63696494-63696516 GCTCCTGGAGGGGCAACTGGAGG - Exonic
1151190296 17:72393314-72393336 GCTGCTGGCTCTGCACCTGGTGG - Intergenic
1151477391 17:74351860-74351882 GCTGCTCCAGCGCCAGCTGCAGG - Exonic
1151822864 17:76506526-76506548 GATGCGGGATCGCCATCTGGTGG + Intergenic
1152067008 17:78117559-78117581 GGTGTGGGTGCGCCACCTGGAGG - Exonic
1152209820 17:78997145-78997167 GGTCCTGGAGTCCCACCTGGCGG - Exonic
1152217550 17:79042529-79042551 CCTGCTGATGCGCCGCCTGGTGG + Intronic
1152378715 17:79931228-79931250 GCACCTGGAGCGACACCTGTGGG + Intergenic
1152947399 17:83205506-83205528 GCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1155027539 18:21956217-21956239 CCTGCATGTGCGCCACCTGGTGG + Intergenic
1155146325 18:23086650-23086672 CCTGCTGTAGCCTCACCTGGCGG + Intergenic
1155264349 18:24076465-24076487 GCTGCTGGAGCGGCCCCTGTAGG + Intronic
1158559988 18:58505528-58505550 ACTGCTGGAGCAATACCTGGAGG - Intronic
1160082065 18:75737190-75737212 CCTACTGGGGCACCACCTGGTGG + Intergenic
1160512300 18:79459359-79459381 GCTGCGGGGCAGCCACCTGGAGG + Intronic
1160621141 18:80171397-80171419 GCTGCTGTGGCGCCCCCTGCTGG - Exonic
1160810001 19:1009176-1009198 GCTGCTGCTGCTCCACCTCGGGG - Exonic
1161014895 19:1978663-1978685 GCTGCTGGGGCCCAGCCTGGAGG + Exonic
1161081981 19:2315844-2315866 AAAGCTGGAGCGGCACCTGGTGG + Intronic
1161931833 19:7345762-7345784 CCTGCAGGAGCTCCAGCTGGGGG - Intergenic
1162105183 19:8365995-8366017 GCTGCTGCTGGGCCACCTTGTGG - Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162739535 19:12766143-12766165 GGAGCTGCAGCGCCACCTGGAGG - Exonic
1162902716 19:13804973-13804995 GCAGCCGCAGCTCCACCTGGTGG - Exonic
1162921680 19:13906627-13906649 GGTGTTGGAGCCTCACCTGGGGG - Intronic
1163146234 19:15380516-15380538 GAAGCTGGAGCGCTACCTGAAGG - Exonic
1163659283 19:18567237-18567259 GCTTCTGGAAGGCCACCTTGGGG + Intronic
1163663252 19:18590847-18590869 ACTGCAGCAGGGCCACCTGGTGG - Exonic
1164541158 19:29122433-29122455 GCTGCTGCAGTGGGACCTGGTGG + Intergenic
1165745181 19:38226387-38226409 TCGGCTGGGGCGCCCCCTGGTGG - Intronic
1166862174 19:45816875-45816897 GCTGCTGGGGCGGCAGCTGCAGG + Exonic
1166863063 19:45820836-45820858 CCTGCTGGTCCGCCACTTGGTGG - Intronic
1166963419 19:46513628-46513650 GGTCCTGCAGCGCCCCCTGGTGG + Intronic
1167203857 19:48086659-48086681 GCAGCTGGTGCTCCACCTGCTGG + Intronic
1167233074 19:48297503-48297525 GCTCCTGGAGCTCCACCTGCAGG + Exonic
1167375070 19:49106832-49106854 CCAGCTGCAGCGCCACCTGCTGG + Intronic
1167573990 19:50309031-50309053 GCAGCTGAAGCGGCAGCTGGAGG + Exonic
1167757595 19:51422095-51422117 GAAGGTGGAGCGCCCCCTGGGGG - Intergenic
1168083806 19:54030060-54030082 TTTGCAGGAGCGCCACCTGGAGG + Intergenic
1168269159 19:55240276-55240298 GCTGCAGCAGTGCCGCCTGGTGG - Exonic
1168324315 19:55530308-55530330 GCTGCGGGAGGCCCACCTGCGGG + Exonic
1168713402 19:58514071-58514093 GCTGCTGGAGCGCCACCTGGCGG - Exonic
927559411 2:24059355-24059377 ACTGCTGGACCAGCACCTGGGGG + Intronic
934188223 2:89764294-89764316 GCAGCTGGAGCAGCAGCTGGTGG - Intergenic
934308383 2:91843660-91843682 GCGGCTGGAGCAGCAGCTGGCGG + Intergenic
934966792 2:98730911-98730933 GCTGCGGGAGATCCACCTGCTGG - Intronic
938742830 2:134248852-134248874 GATGTTGGATGGCCACCTGGAGG + Intronic
941578777 2:167268778-167268800 CCTACTGGAGCACCACCTAGTGG + Intergenic
942678771 2:178455050-178455072 GCCCCTTGAGCCCCACCTGGAGG - Intronic
943622720 2:190167957-190167979 CCTACTGGGGCACCACCTGGTGG - Intronic
946168118 2:217877744-217877766 GCAGCAGGAGGGCCTCCTGGGGG + Intronic
946417540 2:219547924-219547946 ACTGCTGGGGCGCTACGTGGTGG + Exonic
946550025 2:220791257-220791279 GCAGCTGGAGAGCCATATGGGGG - Intergenic
947593184 2:231396279-231396301 GCTGCGGGCGCTCCACCTGCCGG - Intronic
948384318 2:237572156-237572178 AATGCTGGAGCGCCATCTGGTGG + Intergenic
948461339 2:238131306-238131328 GCTGCTGGAGTGCGACCTGCCGG + Exonic
948567305 2:238895377-238895399 GGTGCTGGAGGGCCTTCTGGGGG - Intronic
948602472 2:239115259-239115281 GCAGCCGGAGAGCCACCCGGAGG - Exonic
948661298 2:239508144-239508166 GCTGCTGCAGCGCCCTGTGGCGG + Intergenic
948795934 2:240402124-240402146 GCTGCTGGGGCTCCACCCTGAGG + Intergenic
948911679 2:241008148-241008170 GCTGCTCCAGGGCCACCTGGGGG + Intronic
1169145602 20:3250227-3250249 CCACCTGGAGCGCCGCCTGGAGG + Exonic
1170813361 20:19692794-19692816 GCGGACGCAGCGCCACCTGGTGG - Intronic
1172273461 20:33667350-33667372 GCTGTGGGAGCGCCTGCTGGTGG + Exonic
1172295990 20:33811531-33811553 GCCGCTGGATGGCCTCCTGGGGG - Exonic
1174582121 20:51579448-51579470 GCAGCTGGCGGGTCACCTGGGGG + Intergenic
1174648475 20:52105100-52105122 GCCGCTGGAGCCCCGCCCGGGGG - Intronic
1175181763 20:57153465-57153487 GTTGCTGAAGGGCCACCTTGCGG - Intergenic
1175861179 20:62151256-62151278 GCTGCTGAAGCCCCACCGTGGGG - Intronic
1176143714 20:63556134-63556156 GCTGGTGGAGCGGCGGCTGGCGG + Exonic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1176276537 20:64273668-64273690 GCTGTTGAAGGGTCACCTGGAGG + Exonic
1176933560 21:14841944-14841966 GCTGGTGGAGGAGCACCTGGTGG - Intergenic
1176933594 21:14842095-14842117 GCTGGTGGAGGAGCACCTGGCGG - Intergenic
1176958999 21:15138716-15138738 GCTGCTGGAGACCCAGCTGCGGG + Intergenic
1177783000 21:25639854-25639876 GCTGCTGCTGCGCTACCTGGTGG + Exonic
1178578165 21:33813906-33813928 CGTGCTGGTGGGCCACCTGGAGG - Exonic
1178711672 21:34922668-34922690 CCTGCTGGAGTCCCCCCTGGTGG + Intronic
1178872742 21:36389835-36389857 GGAGCAGGAGCGCCACCTGGGGG + Intronic
1179730220 21:43363588-43363610 GCTGCAGGAGGGGCGCCTGGTGG - Intergenic
1179902281 21:44400414-44400436 GCTGCGGGAGAGGCTCCTGGGGG + Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181104299 22:20564463-20564485 GCTGCTGCAGCGCCACCTGCTGG - Exonic
1182303002 22:29349241-29349263 GCTGCTGGAGAGCTTCCTCGAGG - Exonic
1183531052 22:38353538-38353560 GCTCCGGGCGCCCCACCTGGAGG + Intronic
1184021037 22:41821710-41821732 GTTGCTGGAGCCTCATCTGGAGG + Intronic
1185044657 22:48522986-48523008 GCAGCTGGAGCCCCCCATGGCGG + Intronic
1185327353 22:50233432-50233454 GCAGCTGGAGCTCCCCTTGGTGG + Exonic
1185412819 22:50694935-50694957 GCCGCTGGAGCAGCAGCTGGTGG - Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950668017 3:14509074-14509096 GCTCCTGGAGCGCCCCCTGCTGG - Intronic
951509517 3:23485973-23485995 GCTGGTGAAGCGACACCTGAAGG - Intronic
953484923 3:43286420-43286442 GCTGCTGGAGGGCATCCTGGCGG - Intergenic
954111519 3:48436177-48436199 GCTGTGAGAGCGACACCTGGTGG + Intronic
954138136 3:48591700-48591722 TCTGCTGGAGGGCCACGAGGTGG - Exonic
954584641 3:51722518-51722540 GCCGCTTCATCGCCACCTGGGGG - Intergenic
954622894 3:52005823-52005845 GCTGCGGGGGCGGCGCCTGGAGG + Intergenic
954677445 3:52323690-52323712 GCTCCTGGAGTGCTCCCTGGTGG + Intronic
956546341 3:70407797-70407819 CCTGCTGGGGCACCACCTAGTGG - Intergenic
956558781 3:70550923-70550945 CCTACTGGGGCGCCACCTAGTGG - Intergenic
956892256 3:73624444-73624466 GCTGCTGCGGCGCGACGTGGAGG - Exonic
958042635 3:88244910-88244932 CTTGCTGGGGCACCACCTGGTGG + Intergenic
958768754 3:98401960-98401982 GCTTCTGGAGCCCCAGCAGGAGG + Intergenic
958831798 3:99098924-99098946 CCTACTGGAGCACCACCTAGTGG + Intergenic
960978544 3:123200848-123200870 GCTGCTGGAAAGCCATTTGGAGG - Intronic
961116506 3:124334435-124334457 GCTGGTGGAGCCGCACCTTGCGG - Exonic
961286571 3:125810193-125810215 CCTACTGCAGCGCCACCTAGTGG + Intergenic
961685268 3:128625602-128625624 GCTGCAGGAGCCCCTGCTGGTGG - Exonic
962322388 3:134402645-134402667 TCTGCTGGAGCAACACCTTGTGG - Intergenic
962818170 3:139020819-139020841 GCTCCCGGGGCGCCTCCTGGGGG + Exonic
963363196 3:144303094-144303116 TCTGCTGGGGCACCACCTAGTGG - Intergenic
967072952 3:185977597-185977619 AGGGCTGGAGCGCCACCTTGTGG - Intergenic
968760720 4:2441797-2441819 GCTACTGGGACGCCACCTTGTGG + Intronic
968903669 4:3442314-3442336 GCTCACGGAGCCCCACCTGGGGG + Intronic
969802270 4:9578055-9578077 CCTACTGCAGCGCCACCTAGTGG + Intergenic
970763303 4:19517221-19517243 CCTACTGGGGCACCACCTGGTGG + Intergenic
971263251 4:25076150-25076172 GCCGCTGGAGCAGCAGCTGGTGG + Intergenic
973107799 4:46361599-46361621 GCTACTGGGGCACCACCTAGTGG + Intronic
979495806 4:121380962-121380984 GGTGCTGGAGCGCCACGCGAGGG + Exonic
982389379 4:154848006-154848028 CCTACTGGAGCACCACCTAGTGG + Intergenic
982506151 4:156219680-156219702 AGTGCTGGAGTGGCACCTGGTGG + Intergenic
982538504 4:156637952-156637974 GCTGCTGTAGCGGCTGCTGGTGG - Intronic
984549477 4:181143442-181143464 ACTGCGTGAGCGCCACCTGGTGG - Intergenic
985763799 5:1765820-1765842 GCTGCTGGAGCTCCAGATGTGGG + Intergenic
990007674 5:50963108-50963130 GGTGCAGGAGCGCCCCCTCGTGG - Intergenic
992479235 5:77134193-77134215 ACAGCTGGAGCTCCAGCTGGAGG + Intergenic
992741161 5:79774736-79774758 GCTTTTGGGGCCCCACCTGGTGG + Intronic
997159596 5:131594170-131594192 GCTGCTCCAGCTCCATCTGGGGG + Intronic
997312258 5:132896888-132896910 GCTGCTGAAGAGCCTCGTGGAGG - Exonic
997364733 5:133318722-133318744 GCTGCAGCAGGGCCACCTGAAGG + Intronic
999204240 5:149836762-149836784 GCTGCTGGAGACCGCCCTGGAGG + Exonic
1001844558 5:174910392-174910414 GCTGCTCTAGTGCCACCTGCAGG - Intergenic
1002424502 5:179167275-179167297 GCGGCAGCAGCGCCACCTGGTGG - Intronic
1002915719 6:1526289-1526311 GCTGCCGGAGGGTAACCTGGAGG - Intergenic
1003405190 6:5822083-5822105 GCTGCTGGAACCCCAGCAGGAGG + Intergenic
1003524587 6:6887036-6887058 GCTGAAGGAGCCCCACCAGGTGG - Intergenic
1004517343 6:16331502-16331524 GCTGCAGGAGGGCCAGCAGGGGG - Intronic
1004566302 6:16801247-16801269 CCTGCTGGAGCCCCTTCTGGTGG - Intergenic
1006162960 6:32048609-32048631 GCCGGTGGAGCCCCGCCTGGGGG - Intronic
1006170150 6:32087746-32087768 GGACCTGGAGCGCCACCTGCGGG - Intronic
1007090803 6:39183763-39183785 GCTGCTGTAGTGCCACCTCAGGG + Intergenic
1007789585 6:44301422-44301444 GCTGCTGGAGCGGCACTCGAAGG - Exonic
1009344346 6:62595405-62595427 TCTACTGGGGCACCACCTGGTGG + Intergenic
1009346132 6:62614495-62614517 CCTGCTGGGGCACCACCTAGTGG + Intergenic
1012192982 6:96303451-96303473 GCTGCTTGAGCCTCACCAGGTGG - Intergenic
1012245898 6:96925084-96925106 GCTGCTGGTGCGCCAAGTGGGGG + Intronic
1016253242 6:142072092-142072114 CCTACTGGAGCACCACCTAGTGG + Intronic
1017576538 6:155811249-155811271 GCTGGAGGAGCTCCACCAGGTGG - Intergenic
1018237274 6:161738731-161738753 GATGCTGGACCCCCACCTGCAGG - Intronic
1018613462 6:165663532-165663554 GCTGCTGGCCCGCTACCAGGAGG - Intronic
1020088471 7:5324157-5324179 GCTGCTGGAGCCTCCCTTGGGGG - Intronic
1021668749 7:23013932-23013954 GCTGCCGGAGCTCCACCTGCAGG + Exonic
1022474259 7:30699900-30699922 GCTCCTGGCGCCCCACCTCGTGG + Intronic
1023382587 7:39623578-39623600 GCTGCTGCAGAGCCGCCAGGAGG + Exonic
1025205838 7:56992957-56992979 GCTGCTGGAGCCTCCCCTGGGGG + Intergenic
1025666102 7:63583981-63584003 GCTGCTGGAGCCTCCCCTGGGGG - Intergenic
1026913635 7:74107003-74107025 GATGCTGCAGCTCCTCCTGGGGG - Exonic
1029070464 7:97891936-97891958 CCTACTGCAGCGCCACCTAGTGG - Intergenic
1029648173 7:101871444-101871466 GCCACTGGAGAGCCACTTGGTGG + Intronic
1031301644 7:120068264-120068286 CCTGCTGGGGCACCACCTAGTGG + Intergenic
1034355087 7:150445138-150445160 GCTGCGGGAAGGCCACATGGGGG + Intergenic
1035295450 7:157864659-157864681 GCTGCTGAAACGCAGCCTGGCGG + Intronic
1036091310 8:5668680-5668702 GCTGCTGGAGCTAAACCTGCAGG + Intergenic
1036364789 8:8110903-8110925 CCTACTGCAGCGCCACCTAGTGG + Intergenic
1036886148 8:12555208-12555230 CCTACTGCAGCGCCACCTAGTGG - Intergenic
1036893764 8:12614296-12614318 CCTACTGCAGCGCCACCTAGTGG - Intergenic
1038964320 8:32554858-32554880 GCTCCTGGAGCACCCTCTGGAGG - Intronic
1044934399 8:97278937-97278959 GCTTCTGCAGTGCCACGTGGAGG - Intergenic
1046031430 8:108787488-108787510 GGTGCTGGAGCCGCACCGGGTGG - Exonic
1048861720 8:138728757-138728779 GCTGCTGCAGATACACCTGGAGG + Intronic
1049282955 8:141759796-141759818 GCTGCTGGAGGCCCACGTGTGGG - Intergenic
1049351189 8:142165623-142165645 GCTCCTGGAGCGCCACTGGAGGG + Intergenic
1049419247 8:142509777-142509799 GCTGCAGGAGCCCCAGCTGCTGG - Intronic
1049616462 8:143577724-143577746 CCTGCAGGAGCGGCACCTGCGGG + Exonic
1049681210 8:143919224-143919246 GCTGCTGGAGCGGTGCGTGGAGG - Exonic
1049681620 8:143921201-143921223 GCTACTGGAGCGCTGCGTGGAGG - Exonic
1049724822 8:144140863-144140885 TTTACTGGAGCGCCTCCTGGAGG + Intergenic
1049733806 8:144192694-144192716 GCAGCTGAAGTGCCAGCTGGGGG + Intronic
1049790116 8:144468565-144468587 GCTGCTGGAGGGCCCCTTGAAGG - Exonic
1050690516 9:8222247-8222269 CATGATGGAGGGCCACCTGGGGG - Intergenic
1054877394 9:70111157-70111179 TCTGGTGGAGCGCCACCTGCTGG + Intronic
1056598267 9:88025573-88025595 GCTGCCAGAGTGCCACCTGCTGG - Intergenic
1056985588 9:91361640-91361662 GCTGCGGGTGCGGCACCTGGAGG - Exonic
1057130108 9:92649012-92649034 GCTGCAGGAGCCCCATCTGCAGG - Intronic
1057707989 9:97411867-97411889 GGTGCGGGAGCGCCTCCTGGTGG - Intergenic
1058826114 9:108777423-108777445 GCTGCAGGCTCGCCACCTGCAGG - Intergenic
1060106475 9:120876438-120876460 GCTGGGGGGGCGCCACCCGGGGG - Intronic
1060361076 9:122958245-122958267 GCTCCTGGAGGGCTGCCTGGGGG - Intronic
1060480623 9:124015039-124015061 GCAGCAGCAGCGGCACCTGGAGG + Intronic
1060492350 9:124094195-124094217 GCTGTCGGAGTTCCACCTGGTGG - Intergenic
1060859306 9:126940782-126940804 GGTGCTGCAGCACCACCTGGTGG - Intronic
1060932141 9:127495969-127495991 GGGGATGGAGCGCCAGCTGGTGG + Exonic
1061115421 9:128607685-128607707 ATTGCTGGAGCGACACCAGGTGG + Exonic
1061208527 9:129177680-129177702 GCTGCTGGAGGTGCAGCTGGTGG + Exonic
1061672181 9:132194863-132194885 GCTGCTGCAGTGGCACCTGGTGG + Intronic
1062235914 9:135507506-135507528 GAAGCTAGAGCGTCACCTGGGGG + Intergenic
1062334019 9:136057025-136057047 GCTGCTGGAGGCCCACCCTGGGG - Intronic
1188449608 X:30295200-30295222 CCTACTGGAGCACCACCTAGTGG + Intergenic
1189254129 X:39624168-39624190 CCTGCTGGAGCACAACCAGGTGG + Intergenic
1189298429 X:39935428-39935450 CCTGCTGGTGGGCCTCCTGGTGG + Intergenic
1192998590 X:76539051-76539073 GCAGCTAGGGCGCCTCCTGGGGG + Intergenic
1193842007 X:86418279-86418301 CCTGCTGGGGCACCACCTAGTGG - Intronic
1196616821 X:117775759-117775781 ACTGCAGGAGCTCTACCTGGAGG - Intergenic
1196734955 X:118975095-118975117 GCAGCTGGTGCGCTGCCTGGCGG + Exonic
1199986858 X:152959063-152959085 GATCCTCGAGCGCCATCTGGCGG - Intronic
1200111602 X:153743588-153743610 GCGGCTGGAGCAGCAGCTGGCGG + Exonic
1200161880 X:154013789-154013811 GCTGCTGCCGCGCCCCCTGCTGG - Intronic