ID: 1168714372

View in Genome Browser
Species Human (GRCh38)
Location 19:58518475-58518497
Sequence TGCCATCTCGATGGGGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168714365_1168714372 -5 Left 1168714365 19:58518457-58518479 CCTGCAGCCCCAGCTTCTTGCCA No data
Right 1168714372 19:58518475-58518497 TGCCATCTCGATGGGGCCTGTGG 0: 1
1: 1
2: 1
3: 11
4: 123
1168714361_1168714372 23 Left 1168714361 19:58518429-58518451 CCCTAGCATAGCGAGCAGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1168714372 19:58518475-58518497 TGCCATCTCGATGGGGCCTGTGG 0: 1
1: 1
2: 1
3: 11
4: 123
1168714360_1168714372 24 Left 1168714360 19:58518428-58518450 CCCCTAGCATAGCGAGCAGGGAG 0: 1
1: 0
2: 1
3: 5
4: 70
Right 1168714372 19:58518475-58518497 TGCCATCTCGATGGGGCCTGTGG 0: 1
1: 1
2: 1
3: 11
4: 123
1168714363_1168714372 22 Left 1168714363 19:58518430-58518452 CCTAGCATAGCGAGCAGGGAGGT 0: 1
1: 0
2: 1
3: 5
4: 79
Right 1168714372 19:58518475-58518497 TGCCATCTCGATGGGGCCTGTGG 0: 1
1: 1
2: 1
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168714372 Original CRISPR TGCCATCTCGATGGGGCCTG TGG Intronic
900199889 1:1399703-1399725 GGCCATCTCGGTGGGATCTGGGG + Intronic
900696895 1:4017821-4017843 TGGAATCTGGATGGGGCATGGGG + Intergenic
900843680 1:5078889-5078911 TGCCATCTCTCTGTGGCATGGGG - Intergenic
901643374 1:10704389-10704411 TGCACTCTCGCTGGGGCCGGTGG - Intronic
902056730 1:13606892-13606914 GGCCACCTCGATGGGGCCCCAGG + Intronic
903288052 1:22289399-22289421 TGCCATCTCGGTGGGGATGGTGG + Intergenic
905217787 1:36421580-36421602 TCCCATCTTGAAGGGGCCTGTGG - Intronic
905913447 1:41669390-41669412 TGCCATCTCGACTGGGCCATGGG + Intronic
906526713 1:46497780-46497802 AGCCATCTATATGGCGCCTGTGG + Intergenic
907302725 1:53498657-53498679 AGCCATCTCCACGGGGCCTGGGG - Intergenic
912566413 1:110590745-110590767 GGCAATCTCGATGGGACCTGTGG + Intergenic
913993389 1:143635468-143635490 TGCCAGCTTGATGGGGTCAGAGG - Intergenic
914970691 1:152306077-152306099 TGTCTTCTTGATGGGACCTGGGG + Exonic
914970846 1:152307049-152307071 TGTCTTCTTGATGGGACCTGGGG + Exonic
917460540 1:175225463-175225485 TTCAATCTAGATGGGACCTGGGG - Intergenic
918248941 1:182684678-182684700 TGCCATCCTGCTGGAGCCTGCGG - Intergenic
920251333 1:204624325-204624347 TGCCTTCTGAATGGGGGCTGGGG + Intronic
920871467 1:209798536-209798558 TGCAATCTGGGTGGGTCCTGGGG - Intronic
921955561 1:220980120-220980142 TGCCATCTGCCTGGGGCATGGGG - Intergenic
922798965 1:228355442-228355464 AGCCAGCAGGATGGGGCCTGTGG - Intronic
1062822730 10:547219-547241 TGGCCTCGCGATGGGGGCTGGGG - Intronic
1067476792 10:46572733-46572755 TGCCCTCTGGGTAGGGCCTGTGG + Intergenic
1067617946 10:47769047-47769069 TGCCCTCTGGGTAGGGCCTGTGG - Intergenic
1071289333 10:84177183-84177205 TGCCCTCTCCCTGAGGCCTGGGG + Intronic
1077090360 11:775624-775646 TGCGTTCTCCATGGTGCCTGAGG - Intronic
1077109742 11:856934-856956 TGCCAGCACGCTGGGGCCTCGGG + Intronic
1077289424 11:1782052-1782074 TGCCTGCTCCCTGGGGCCTGGGG - Intergenic
1077744861 11:4891248-4891270 TGCCATCTGGTTGGGCTCTGGGG + Intronic
1081279402 11:41189648-41189670 TGCCATCACCTTGGGGCATGTGG - Intronic
1083310563 11:61781567-61781589 GGCCATCTGGCTGGGGCCTGTGG - Exonic
1083572737 11:63768875-63768897 TGCCAGCTCGCGGGGGGCTGGGG + Intergenic
1084120250 11:67064940-67064962 TGCCCTCTGGATGGGGGCAGGGG - Intronic
1084640372 11:70422366-70422388 TGCCATCTCCATGCAGTCTGCGG - Intronic
1084768561 11:71327860-71327882 GGCCAACACGATGGGGACTGAGG - Intergenic
1086342091 11:85857248-85857270 GGCCATCTCCATGGGTCCTATGG - Intronic
1087756818 11:102063200-102063222 TGCCACCTCGGTGGGTCCAGAGG + Intronic
1087831176 11:102821215-102821237 TGCCATATCCATGGGGACTTTGG + Intergenic
1089535568 11:119158823-119158845 CGCCATCTCTAAGGGGACTGAGG - Exonic
1089615098 11:119690744-119690766 TAGCATCTGGGTGGGGCCTGGGG + Intronic
1091446719 12:547972-547994 CGCCATCTCCATGGGCCCTGGGG - Intronic
1091589788 12:1836324-1836346 TGGAATCTCGATGGGGGCTCAGG + Exonic
1091800013 12:3319182-3319204 TGTCATCTCTCTGGGGCTTGAGG - Intergenic
1092333473 12:7606872-7606894 TGCCATGTGCCTGGGGCCTGGGG - Intergenic
1093097624 12:14989824-14989846 TGCCATGGACATGGGGCCTGTGG - Intergenic
1093219209 12:16399068-16399090 TGCCATCTGAATGGGGCCATTGG + Intronic
1097623022 12:61964559-61964581 TGTCATATCGAGGGAGCCTGGGG - Intronic
1104677464 12:130722426-130722448 TGCCTTTTAGATGGGGCATGTGG - Intergenic
1104948759 12:132429335-132429357 TGTCCTTTCCATGGGGCCTGTGG + Intergenic
1112414100 13:99190137-99190159 TCCCTCCTCGATGGCGCCTGTGG + Intergenic
1113196474 13:107813697-107813719 TGACATCGGGATGGGGCTTGTGG + Intronic
1113945671 13:114042840-114042862 TGCCATCTCAGTCGGTCCTGCGG + Intronic
1114298512 14:21352466-21352488 TGCCATCTGAATGGGGCCATTGG + Exonic
1118332687 14:64826097-64826119 TGCCATCTGGGCAGGGCCTGGGG - Intronic
1120865333 14:89291498-89291520 CGCCATCCCCAGGGGGCCTGTGG + Intronic
1121277732 14:92679239-92679261 TGCCCTCTCTATGGGGCCAGAGG - Intronic
1121717817 14:96088756-96088778 TGCCATCTCCATGGGCCATTTGG - Exonic
1122972045 14:105156275-105156297 TGCCTTCTCTGTGGAGCCTGTGG - Intronic
1125748449 15:42012921-42012943 TCCCCTCTGGATGGGGCCAGGGG + Intronic
1130844807 15:87734707-87734729 TGACATCTCCTGGGGGCCTGGGG - Intergenic
1133444775 16:5850790-5850812 TGCCATCTCGAAAGGGCCCCGGG + Intergenic
1135338823 16:21629237-21629259 TACCATCACGATGGGGGGTGGGG - Intronic
1141748953 16:85945584-85945606 AGCCATCTCCATGGGCCCCGCGG - Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143400595 17:6639987-6640009 TGCAGCCTCGATGGAGCCTGGGG + Intronic
1144191913 17:12854152-12854174 TGCCATCTCCATCTGGACTGAGG - Intronic
1145057795 17:19714646-19714668 TGCCATCTCCATGGCACCTGTGG + Intronic
1147686425 17:42289055-42289077 AGCCCTCTCCAGGGGGCCTGTGG + Intronic
1148737171 17:49871345-49871367 TGCCAACTTGGCGGGGCCTGCGG + Intergenic
1149531325 17:57397554-57397576 TGCCATCTCCATGGCTACTGAGG - Intronic
1151215535 17:72574375-72574397 TGCCATGTCACTGGTGCCTGTGG + Intergenic
1152935909 17:83136553-83136575 AGGGATCTTGATGGGGCCTGTGG - Intergenic
1156728835 18:40164763-40164785 TGCCAGCTACATGGGGGCTGAGG + Intergenic
1160096158 18:75875627-75875649 TTCCATCTGGATGGGGCCACGGG - Intergenic
1160518487 18:79491074-79491096 AGCCATCTTGATGGGGACAGCGG + Intronic
1161170013 19:2807899-2807921 TGCCTGCTCCATGGGGCCTCGGG + Intronic
1161604003 19:5204470-5204492 TGCCTTCTCGAAGTGCCCTGGGG - Intronic
1163831843 19:19550728-19550750 GGCCAGCACGATGGAGCCTGAGG + Intergenic
1168136466 19:54355493-54355515 GGCCATCTCCATGGGCCCTGAGG + Intronic
1168714372 19:58518475-58518497 TGCCATCTCGATGGGGCCTGTGG + Intronic
925181156 2:1817689-1817711 TGCCATCTAGCGGTGGCCTGGGG + Intronic
925196924 2:1933184-1933206 TGTCATCTCGGTGGGGGCTGTGG - Intronic
927862248 2:26567527-26567549 TGCCAGCTTCCTGGGGCCTGGGG + Intronic
929440752 2:41964341-41964363 TGCCATATAGATGCAGCCTGTGG - Intergenic
932414724 2:71566670-71566692 TGCCATCTCCCTGGGGCTGGTGG + Intronic
936890073 2:117359338-117359360 TGCTATCTCCATGGGGCCTGGGG + Intergenic
937042847 2:118835041-118835063 TGCCTTCTCGGTGCGGGCTGGGG - Intergenic
937248666 2:120510168-120510190 GGCCACCTCCATGGGGGCTGTGG + Intergenic
944721848 2:202430611-202430633 TGCCAACTGGATGGGTCCTTTGG + Intronic
946366030 2:219249590-219249612 TGACATCAGCATGGGGCCTGGGG + Exonic
947739504 2:232478698-232478720 CGGCACCTCCATGGGGCCTGGGG + Intergenic
948599448 2:239100041-239100063 TGCAGACTCCATGGGGCCTGCGG - Intronic
948950615 2:241248851-241248873 TGACATTTTAATGGGGCCTGTGG - Intronic
1169534622 20:6525144-6525166 TGCCCTCTCCTTGGGCCCTGGGG + Intergenic
1177182967 21:17763456-17763478 TGACAACACGATGGGCCCTGAGG - Intergenic
1180957182 22:19746314-19746336 GCCCATCTCCATGGGGCCCGCGG + Intergenic
1180983186 22:19888985-19889007 TGGCGTCTCGATGGGACCTGAGG - Intronic
960145855 3:114201383-114201405 TGACATCTGTAGGGGGCCTGGGG - Intergenic
965384796 3:168032920-168032942 TTCCATGTCTATGGGGCATGGGG + Intronic
968517148 4:1020185-1020207 GGCCATCTCGATGGGGCCTGGGG - Intronic
975373572 4:73615768-73615790 TGAGATCTGGATGGAGCCTGAGG + Intronic
975681382 4:76880086-76880108 AGCCCTCTAGATGGGGACTGAGG + Intergenic
985436715 4:189937290-189937312 TGGCATCTGCATGGCGCCTGTGG - Intergenic
985594929 5:783856-783878 TGCTGTCTTGATGGGGCTTGGGG - Intergenic
986312907 5:6568013-6568035 TGCCATATGGCAGGGGCCTGTGG - Intergenic
988857852 5:35246794-35246816 TGCCATCTCAAGGTGGGCTGGGG + Intergenic
998753682 5:145352468-145352490 TTCCTTCTCTATGGGGCCTCGGG - Intergenic
999187767 5:149725565-149725587 AGCCATTTCCATGGAGCCTGGGG + Intergenic
1000125769 5:158242381-158242403 TGGCATCGTGATGGGCCCTGGGG + Intergenic
1004286087 6:14322237-14322259 TGCCATCCAGATTGGGCCTGAGG - Intergenic
1005210265 6:23452569-23452591 TGCCAGCTTGTTGAGGCCTGAGG - Intergenic
1011930269 6:92701889-92701911 TGCCAACTCAATAGGGCGTGGGG + Intergenic
1019528121 7:1489997-1490019 TTCCATCTCGGTGGCTCCTGGGG - Intronic
1019764895 7:2843333-2843355 TGCCCTCTCTAGGGTGCCTGGGG - Intronic
1026938994 7:74275772-74275794 CTCCATCTCCAGGGGGCCTGCGG + Intergenic
1027682115 7:81233723-81233745 TGCCAACTCTTTGGGGCGTGGGG + Intergenic
1028660365 7:93265439-93265461 TGCCAGCTGGATTTGGCCTGTGG + Intronic
1030371096 7:108700093-108700115 TTCCATTGTGATGGGGCCTGGGG + Intergenic
1032429912 7:131852304-131852326 TGCAGTCTGCATGGGGCCTGGGG - Intergenic
1032580620 7:133099984-133100006 TGGCCTCTCTATGTGGCCTGGGG - Intergenic
1034393389 7:150802304-150802326 TGCCATCTGGACAGGGGCTGTGG + Exonic
1034558555 7:151865159-151865181 TGCCATGGCCAAGGGGCCTGAGG + Intronic
1042200301 8:66274786-66274808 TGCCATCTGGAGGGTGCCGGTGG - Intergenic
1042253599 8:66781041-66781063 TGGCAGATGGATGGGGCCTGCGG - Intronic
1044960905 8:97529877-97529899 TGCCATCTTGCTGGGGAATGTGG - Intergenic
1047178605 8:122566195-122566217 TGGCCTCTCCATGGGGACTGGGG + Intergenic
1048050639 8:130812627-130812649 TGCCCTCTCCATAGGGTCTGGGG - Intronic
1054722053 9:68614124-68614146 TGACATCTCCGTGGGGCCTCAGG - Intergenic
1057273775 9:93665510-93665532 TCCCATCTCAACTGGGCCTGAGG + Intronic
1060266733 9:122116007-122116029 TGCCAGCTCTCTGGGGCTTGTGG + Intergenic
1062623419 9:137432779-137432801 TGCCACCTCGGTGGGCCTTGGGG + Intronic
1186674794 X:11804898-11804920 TGACATCTCCTTTGGGCCTGTGG + Intergenic
1189031288 X:37453582-37453604 TGCCATTCCTATGGTGCCTGTGG + Exonic
1192180900 X:68914896-68914918 CGCCATCTAGGTGTGGCCTGGGG + Intergenic
1196104247 X:111879337-111879359 TATCATCCCAATGGGGCCTGTGG + Intronic
1197406902 X:126065041-126065063 TGCCAACTCGGTAGGGCATGGGG - Intergenic
1199972675 X:152872441-152872463 TGCCATTCAGATGGGGCTTGAGG + Intergenic
1200053875 X:153448690-153448712 TGCCATCCTGGTGGTGCCTGGGG - Intronic