ID: 1168714473

View in Genome Browser
Species Human (GRCh38)
Location 19:58518943-58518965
Sequence CTGGCTGAGCAAAGGGACGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168714473 Original CRISPR CTGGCTGAGCAAAGGGACGG CGG (reversed) Intronic
901236198 1:7668966-7668988 CTGGCTGAGAAGAGTGCCGGCGG - Intronic
901304333 1:8221738-8221760 ATGGCTGAGCAGAGGCATGGAGG + Intergenic
901683263 1:10928668-10928690 GTTGCTGAGCACAGGGATGGCGG + Intergenic
902287124 1:15413940-15413962 CTGGAGGAGCAAAGAGAGGGAGG - Intronic
902696318 1:18143163-18143185 CTGGCTGAGCTCAAGGACGCAGG - Intronic
903373844 1:22853652-22853674 CTGCCTGAGCAAAGGCCCAGAGG + Intronic
903976664 1:27154698-27154720 TTGGCTGAGGAAAGTGACTGAGG + Exonic
904596857 1:31652231-31652253 CTGGCTGACCACAGGCAAGGAGG + Exonic
904603887 1:31688690-31688712 CTGGGGCAGCACAGGGACGGAGG + Intronic
904769279 1:32871855-32871877 CTGGCTGAGATGAGGGAAGGGGG - Intronic
904896693 1:33823161-33823183 CTGGCTGAGGAAAGGGGAGGCGG - Intronic
905314407 1:37072597-37072619 CTGGCTGGGCAGAGGGTTGGGGG - Intergenic
905329154 1:37180031-37180053 GTGGCTGAGCAGAGTGATGGAGG - Intergenic
906048409 1:42850995-42851017 CTGCCTGAGGAAGGGGAAGGGGG + Exonic
906692557 1:47802185-47802207 CTGGCTGGGCACAGGCACGGTGG - Intronic
908256488 1:62308005-62308027 CGGGGTGAGCAAAGGCACAGGGG - Intronic
915245559 1:154553793-154553815 CTCACTGAGCATAGGGAAGGAGG + Intronic
917230188 1:172828130-172828152 TTGGATGAGCAAAGGCACGGAGG + Intergenic
917790301 1:178495060-178495082 TTAGCTGGGCAAAGGGACTGGGG - Intergenic
920068023 1:203282824-203282846 GTGGCTGAGAATAGGGAAGGTGG + Intergenic
920414564 1:205790097-205790119 CTGGTTGAGCAATGGGGCGGTGG + Exonic
920659973 1:207907420-207907442 CTGGATGAGCAAAGGTAGGCAGG - Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
921257263 1:213353917-213353939 CAGCCTGAGCAAAGGCACAGAGG + Intergenic
922162617 1:223089525-223089547 CTGACTGAGCACAGGGATGGGGG - Intergenic
923304338 1:232674399-232674421 CTGCCTGAGAAGAGGGACTGAGG - Intergenic
924923654 1:248657681-248657703 AGGGCTGAGCGAAGGGAGGGAGG + Intergenic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1065369401 10:24968441-24968463 CTGGATGAGCAAGGGGATGTTGG - Intergenic
1066336277 10:34481496-34481518 CTGGCTTAGCAAAGGACCTGGGG - Intronic
1066656348 10:37702229-37702251 CTGGCTGAGGACAGGGAGGAGGG - Intergenic
1067357654 10:45545799-45545821 CTGGCTGAGTGAAGGGAAGAAGG - Intronic
1071300875 10:84255249-84255271 CGATCTGAGCAAAGGGAGGGTGG - Intronic
1073054013 10:100687459-100687481 CTGGGTGAGGACAGGGAAGGAGG + Intergenic
1073084644 10:100880308-100880330 CTGGATGTGCAAAGGGCCAGGGG - Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1074329570 10:112491886-112491908 CTGGCTGAGGGAAGAGGCGGAGG - Intronic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1075105652 10:119538498-119538520 CTGGGGGAGCAAAGGCACAGAGG + Intronic
1075512188 10:123081509-123081531 CTGGCTGGGGAGAGGGGCGGCGG - Intergenic
1075728684 10:124623556-124623578 CTGCCTGAGCGCAGGGACAGAGG - Exonic
1076019705 10:127062546-127062568 GTGGCTGAGCTAAGGGGCTGTGG + Intronic
1078446602 11:11409492-11409514 CTGGCTGAGCACAGGAAGGCTGG - Intronic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1081626439 11:44658804-44658826 AGGGCTGAGCAGAGGGAGGGAGG + Intergenic
1081632526 11:44699579-44699601 CTGCATGAGCAAAGGCATGGAGG + Intergenic
1083718152 11:64590957-64590979 GTGGCTGAGCCAAGAGAAGGTGG - Exonic
1085993815 11:81886217-81886239 CTGGATGACCAAAAGGACAGTGG + Intergenic
1086949531 11:92877353-92877375 CTGGTTGTGCAGAGGGAAGGTGG - Intronic
1089619147 11:119712622-119712644 GTGGCTGGGGAAAGGGAGGGAGG - Intronic
1090075820 11:123579453-123579475 CTGGCTGTGGACAGGGAAGGAGG + Intronic
1090246353 11:125218521-125218543 TAGGCTGAGCAAAAGCACGGAGG + Intronic
1091208401 11:133835966-133835988 CAGGCTGTGCCAAAGGACGGCGG - Intergenic
1091409847 12:232199-232221 CTGGCAGAGAAAAAGGACAGAGG - Intronic
1091674203 12:2476731-2476753 TTGTCTTAGCAAAGGGATGGTGG - Intronic
1091801066 12:3324725-3324747 TTGGCTGAGTAAATGGAAGGTGG + Intergenic
1096069341 12:48766339-48766361 CTGGGTGAGGAAAGGGACAATGG + Exonic
1096283296 12:50275702-50275724 CTGCATGAGCAAAGGCACAGAGG + Intronic
1097282196 12:57852009-57852031 CTGCCTGTGCAAAGGTAGGGAGG - Intergenic
1097633120 12:62088439-62088461 CTGTCTGAGCAGAAGGACCGGGG - Intronic
1098449978 12:70609440-70609462 CTGGCTGAGGCAAGGGACAAAGG - Intronic
1100121619 12:91375263-91375285 TTGGCTGGGCAAAGGGAAGGCGG + Intergenic
1101502319 12:105315673-105315695 CTGCATGAGCAAAGGTATGGTGG + Intronic
1101559969 12:105847621-105847643 CTGCCTGAGCCAAGGCACAGAGG + Intergenic
1102028862 12:109728575-109728597 CAGTCTGAGCAAAGGCACAGAGG - Intronic
1102436393 12:112927436-112927458 ATGGCTGAGAATAGGGAGGGAGG - Intronic
1102646871 12:114409313-114409335 CTGGCTGAGAGAAAGGACGCGGG - Intergenic
1103602856 12:122065091-122065113 CTGACTGAGCAGAGGGCTGGAGG + Intergenic
1106735724 13:32586488-32586510 CTGGCTGCGGAAGGGGAGGGGGG + Exonic
1111505539 13:89184286-89184308 CTTGCTATGCAAAGAGACGGTGG - Intergenic
1112002335 13:95222420-95222442 CCTGCTGAGCAAAGGGGTGGAGG + Intronic
1112128651 13:96497565-96497587 ATGTCTGAGCAAAGGGGCTGGGG - Intronic
1113058828 13:106299193-106299215 CTGGATGGGCAAAGGGACTCAGG - Intergenic
1115771310 14:36666162-36666184 CTGGGAGAGCAAAGGGGCGAAGG + Intronic
1118570251 14:67187749-67187771 CAGTCTGAGCAAAGGCACAGAGG - Intergenic
1119399088 14:74349641-74349663 CTGGGTGGGCCAAGGGATGGAGG - Intronic
1119557789 14:75566908-75566930 GGGGCTGAGCAGAGGGAAGGAGG + Intergenic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1119965040 14:78905175-78905197 CAGGCTGGGCAAAGGAAAGGAGG - Intronic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122232623 14:100314283-100314305 CTTGCTGTGCAAACGGAGGGTGG + Intergenic
1122717959 14:103706713-103706735 CTGGCTGAGCACAGCGATGCCGG - Intronic
1122911058 14:104827764-104827786 CTGGCTGAGCAAAGGACAGGAGG - Intergenic
1124594598 15:31082349-31082371 CCGGCTGAGTGAAGGGACAGTGG + Intronic
1125920568 15:43523109-43523131 CTGGCTGAACAAAGGGACACAGG + Exonic
1129252294 15:74315722-74315744 CTGCGTGAGCAAAGGCACAGAGG + Intronic
1129762316 15:78137008-78137030 CTGGCTGTGCTAATGGACTGAGG - Intronic
1130373638 15:83308857-83308879 CTTGCTGAGCAAAGGCACGGAGG - Intergenic
1131283658 15:91040245-91040267 CTGGCAGAGCACAGGGTGGGTGG - Intergenic
1132111390 15:99104847-99104869 CGGGCTCAGCGAAGGGACGCCGG - Intronic
1132201062 15:99955134-99955156 CAGGCTGTGCAAGGGGACAGAGG - Intergenic
1132591073 16:726750-726772 CTGGCTGAGCCCCGGGACGGGGG + Intronic
1132797741 16:1733629-1733651 CAGGACGAGCCAAGGGACGGGGG - Intronic
1132802371 16:1760782-1760804 TTGGCTGATCAAAGGGCTGGAGG - Intronic
1134451860 16:14368614-14368636 CTGGCTGTGCAAAGGCCCTGGGG - Intergenic
1134858218 16:17538120-17538142 CTAGCTGGGCAAAGGCAGGGTGG + Intergenic
1135156733 16:20059158-20059180 CGGGCTTAGCAAAGAGAGGGAGG - Intronic
1135533523 16:23274974-23274996 CTGGTTGAGGAAAGGGTAGGTGG + Intergenic
1138604947 16:58082617-58082639 CAGCCTGAGCAAAGGGCCTGAGG - Intergenic
1138658522 16:58504110-58504132 ATGGCTGAGCAGAGGGGCCGGGG - Intronic
1139795911 16:69482699-69482721 CTGGCTGGGCAAAGAGCCAGTGG - Intergenic
1140107382 16:71973180-71973202 CTGCCTGGGCAAAAGGAGGGAGG - Intronic
1141765112 16:86053002-86053024 CTGCCTGAGCAAAGGCCTGGAGG + Intergenic
1141778071 16:86137778-86137800 ATGGCAGAGCAATGGGATGGAGG - Intergenic
1142051998 16:87965078-87965100 CTGGCTGAGCAAAGGTTCCAGGG + Intronic
1144804421 17:17954931-17954953 GGGGCTGAGCAAATGGATGGAGG - Intronic
1146924322 17:36733523-36733545 CTGGCTGTGCTATGGGTCGGGGG + Intergenic
1147216952 17:38906225-38906247 CTGGCTGAGGAAAGGAAATGAGG + Intronic
1147588720 17:41667540-41667562 CAGCCTGAGCAAAGGCACAGGGG + Intergenic
1147873709 17:43605907-43605929 CTGGCTGAGCAAAAGAAAGAAGG - Intergenic
1148752297 17:49952194-49952216 CTGCCTGAGCAAAGAGTCTGTGG - Intergenic
1149581247 17:57751879-57751901 CTGGTAGAGCAAGGGGTCGGGGG + Intergenic
1150144120 17:62753633-62753655 CTGAGTGTGCAAAGGAACGGAGG - Intronic
1150266861 17:63837694-63837716 CTGGCTGACGAGAGGGATGGAGG - Intronic
1151440997 17:74129023-74129045 AGGGCTGAGCCAAGAGACGGAGG + Intergenic
1151654691 17:75490402-75490424 CTGGCTGTGCCAGAGGACGGGGG + Intronic
1151951431 17:77356367-77356389 GTGGCTGAGAACAGGGACGTGGG + Intronic
1153671239 18:7414533-7414555 CTGGCAGAGCACAGGGAGGAGGG + Intergenic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1154437532 18:14358131-14358153 CAGGCTGTGCTAAGGGACAGTGG - Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1160329257 18:77977308-77977330 GTGGCAGAGCAAAGGGACCTCGG + Intergenic
1161157281 19:2739218-2739240 CTGGCTGAACACATGGACGAGGG + Intronic
1161709697 19:5841157-5841179 ATCGCTGGGCAAAGGGAGGGTGG + Intergenic
1161797274 19:6394255-6394277 TTGGCTAAGCAAAGGGAAGGCGG + Intergenic
1162533946 19:11252342-11252364 CTGGTGGAGCACAAGGACGGTGG - Intronic
1164834547 19:31349264-31349286 CGGGCTGAGGACAGGGAGGGAGG + Exonic
1164915974 19:32052601-32052623 CTGGCTGAGAAAGGGGACAATGG + Intergenic
1165127837 19:33613250-33613272 CTCTCTGAGGACAGGGACGGGGG + Intergenic
1166084709 19:40467166-40467188 CTGGCTGAGCCGCGGGCCGGCGG + Intronic
1168311982 19:55465068-55465090 TGGGCTGAGCAGAGGGAGGGAGG - Intergenic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
925103423 2:1268946-1268968 CTGGCTGAGCAGAGTCCCGGTGG + Intronic
925145950 2:1583449-1583471 CAGGCTTAGCACAGGGACTGGGG - Intergenic
925210965 2:2045732-2045754 CCAGCTGAGCAAAGGCACTGAGG - Intronic
926418672 2:12675725-12675747 CTGGCAGAGCAGAGGGTGGGAGG - Intergenic
927307899 2:21594976-21594998 CTTGCTGACCAACGGGAGGGAGG - Intergenic
929791106 2:45023792-45023814 ATGGCTGGGCAAAGGAAGGGAGG - Intergenic
929942680 2:46346921-46346943 CCGGCGGAGCAAGGAGACGGAGG + Exonic
930514882 2:52393854-52393876 CTTGCTCTGCAAAGGGACTGAGG - Intergenic
935532158 2:104247672-104247694 CAGGATGAGCAAAGGGAAAGAGG + Intergenic
941439267 2:165513169-165513191 CTGACAGAGCAAAGGGCCTGGGG - Intronic
941995749 2:171600620-171600642 GTGGCCCAGGAAAGGGACGGAGG + Intergenic
942562002 2:177229719-177229741 GTGGCTGAAGAAAGGGATGGGGG - Intronic
943582556 2:189702047-189702069 CTGGCTGGCCTAAGGGACAGGGG - Intronic
948830787 2:240597375-240597397 CTGGCTGAGCTCAGTGACTGTGG - Intronic
948878841 2:240845355-240845377 CTTGCTGTGCAAAGAGACTGGGG + Intergenic
949009133 2:241668479-241668501 CCGGCAGAGGAAAGGGACAGAGG - Intronic
1168961880 20:1875649-1875671 CTGCATGAGCAAAGGTAAGGAGG - Intergenic
1169335063 20:4749060-4749082 CTGACTGAACAAAGAGAAGGAGG + Intergenic
1169715096 20:8607132-8607154 CTGGCTGAGGAATGGGATGTGGG - Intronic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1170658933 20:18317251-18317273 CTGTCAGAGCCAAGGGATGGGGG - Intergenic
1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG + Intronic
1172129265 20:32645034-32645056 CTGGCTTAGGAATGGGAAGGGGG - Intergenic
1174276797 20:49409861-49409883 CTGTCTGAGCAAAGGTAGGGAGG - Intronic
1175201813 20:57283310-57283332 AGGGCTGAGCAAAGGGCCGCCGG - Intergenic
1175771724 20:61628330-61628352 CCGGCTGAGCACAGGGGTGGGGG - Intronic
1179477992 21:41660051-41660073 CTCGCTGAGGAAAGGGGCTGTGG + Intergenic
1179499068 21:41795526-41795548 TTGGCTGAGCATAGGGTCAGTGG + Intergenic
1179566818 21:42254060-42254082 CTGGTGGAGGAAAGGGACTGGGG + Intronic
1179669796 21:42938656-42938678 CTATCTGAGGAAAGGGAGGGGGG + Intergenic
1179925633 21:44532733-44532755 CTGGCCGAGCTAGGGGACTGAGG + Intronic
1180164512 21:46017027-46017049 CTGGTCTAGCAAAGGGAGGGAGG + Intergenic
1181266956 22:21636041-21636063 ATGGCTGAGGAAAGGGTCGAGGG - Intronic
1181568319 22:23752697-23752719 CTGGCTGAGAAAAATGACTGTGG - Intergenic
1181604005 22:23969108-23969130 TTGTCTGAGCAAAGGGAGAGTGG - Intronic
1181604508 22:23972198-23972220 TTGTCTGAGCAAAGGGAGAGTGG + Exonic
1181623947 22:24109623-24109645 GTAGCTGAGCAAAGGGTTGGTGG + Intronic
1181761995 22:25065074-25065096 CTGCCTGAGCATAGGCAGGGAGG + Intronic
1181928947 22:26383805-26383827 CAGGCTGAGCTAAGAGAGGGAGG - Intergenic
1182048585 22:27296300-27296322 CGGGCTGAGCAACTGCACGGTGG - Intergenic
1182321435 22:29480496-29480518 CACGCTGAGCAACGGGCCGGAGG + Exonic
1183318551 22:37149825-37149847 CTGGCTGAGACATGGGGCGGTGG + Exonic
1183515363 22:38262447-38262469 CTATATGAGCAAAGGCACGGAGG + Intronic
1184556470 22:45235916-45235938 CTGGCCTAGCAAAGTGATGGCGG + Intronic
1184731701 22:46374221-46374243 CTGGCTCAGGAAAAGGAAGGGGG + Intronic
954080266 3:48209471-48209493 CGGCCTGAGCAAAGGCATGGTGG - Intergenic
954144209 3:48626338-48626360 CTGGCTGACCACAGGGCCTGTGG + Exonic
957080264 3:75630964-75630986 CTGGCTCTGCAAAGGGACTAGGG - Intergenic
958678943 3:97300703-97300725 CTGGCCTATCAAAGGGACAGGGG + Intronic
959571843 3:107893210-107893232 CTGGCTAAGCCAAGGCATGGAGG + Intergenic
960221418 3:115113859-115113881 CTGGTTGAGCAAATAGAAGGTGG - Intronic
961603723 3:128078501-128078523 GTGGCTGAGGAGAGGGAGGGAGG - Intronic
962837562 3:139202709-139202731 CTGGGTGAGGACAGGGACTGGGG - Intronic
963745053 3:149117423-149117445 CAGGCTGAGCAAAGGAAGGTAGG - Intergenic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
967105833 3:186254440-186254462 CAGGCTGTGCAAAGGCAGGGAGG - Intronic
967358030 3:188595468-188595490 ATGGCAGAGCAAGGGGAGGGTGG - Intronic
968430300 4:554549-554571 CTGGCTGAGCAGAGGCCAGGTGG - Intergenic
968443497 4:636386-636408 CTGGCTGAGAGAGGGTACGGGGG + Intronic
968507981 4:980769-980791 CTGGCTGATAAGAGGGAAGGAGG - Intronic
970162806 4:13206157-13206179 ATGCCTGAGCAAAGGGCAGGAGG - Intergenic
971153841 4:24061843-24061865 CTGGCTGAACCAAGAGAAGGTGG - Intergenic
971196424 4:24474732-24474754 CTGGCTGAGAAAAAGAAGGGAGG + Intergenic
971422940 4:26490527-26490549 CTGGCCCAGGAAAGGGCCGGGGG - Intergenic
972323235 4:37991916-37991938 CTGCATGAGCAAAGGTATGGAGG + Intronic
972682411 4:41319045-41319067 CTGGCTGAGTCAAGAGATGGCGG - Intergenic
975678575 4:76852285-76852307 CTGGCTGAGTCAAGGGACAGGGG + Intergenic
978279029 4:106987542-106987564 CTGCCTGAGGAAAGGGACGCAGG + Intronic
981545144 4:145885947-145885969 CTGGGGCAGCAAAGGGAAGGAGG - Exonic
983516034 4:168657735-168657757 CTGGCAAAGAAAAGGGAAGGTGG - Intronic
985421710 4:189791092-189791114 CTGGCTGAGTAAAGGAGCAGAGG - Intergenic
985551177 5:534387-534409 CTGGCTCAGCACAGGGTAGGGGG + Intergenic
985778279 5:1856791-1856813 CGGGCTGAGCACAGGGCCAGGGG + Intergenic
987112521 5:14701073-14701095 CTGGCTGAGCCCAGGAAGGGCGG - Intergenic
991014740 5:61918706-61918728 CTGGCTGAGCAAACGGACTCAGG + Intergenic
992150180 5:73895005-73895027 CAGGCTGAGGGAAGGGAGGGTGG + Intronic
993899009 5:93571957-93571979 CTGACTGAGCAAAGGGAAATCGG + Intergenic
997957003 5:138286553-138286575 CTGGGTGTCCAAAGGGACGATGG + Exonic
1001036516 5:168300531-168300553 CTGCCAAAGAAAAGGGACGGAGG + Intronic
1001200421 5:169711054-169711076 CAGGCAGAGCAAAGGAACTGAGG - Intronic
1001589961 5:172858431-172858453 GTGTCTGAGCAAGGGGCCGGTGG + Intronic
1002349148 5:178570739-178570761 CAGGCTGAGCACATGGAGGGGGG + Intronic
1002415967 5:179121226-179121248 CACGCTCAGCAAAGGGTCGGCGG + Intronic
1004045526 6:12019241-12019263 CTGAGTAAGCAAAGGGACAGAGG + Intronic
1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG + Intergenic
1005372898 6:25153693-25153715 CAGGCTGAGAAAAGGGGCAGAGG + Intergenic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1006934882 6:37710382-37710404 CTGGGTGAGCACAGAGAGGGAGG - Intergenic
1009271461 6:61620386-61620408 CTGGCTCAGCAAAGGAACTTTGG - Intergenic
1016451019 6:144182365-144182387 CTGGCTGAGCCAAGAGAGGTGGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019921491 7:4166199-4166221 CTGCCTGGGCAAAGGCAGGGAGG + Intronic
1021629346 7:22629202-22629224 CTGGCTTAGAAAATGGAGGGAGG + Intronic
1021924804 7:25523943-25523965 AGGCCTGAGCAAAGGGAAGGGGG + Intergenic
1021972765 7:25981664-25981686 CTGTCTTAGCAAAGGGAAAGAGG - Intergenic
1024569990 7:50715282-50715304 CTGGCAGGGCAAGAGGACGGCGG + Intronic
1026890235 7:73977454-73977476 CTGGCTGAAGAAAGGGCAGGTGG + Intergenic
1029977501 7:104848612-104848634 GTGTCTGAGGAAAGGGAGGGAGG + Intronic
1031516533 7:122707003-122707025 CTGGCTGAGCACATGGCCAGAGG + Intronic
1034625040 7:152485964-152485986 CTGCGTGAGCAAAGGCACAGAGG - Intergenic
1034967467 7:155400153-155400175 ATGGCAGGGCAATGGGACGGGGG - Intergenic
1035171287 7:157018773-157018795 CTGCCTGAGCTAATGGACGAGGG + Intergenic
1035482459 7:159198252-159198274 ATGGCTGAGCATGGAGACGGTGG + Intergenic
1036095352 8:5718168-5718190 CTGGCTGAGAGAAGTGAAGGAGG + Intergenic
1037638693 8:20723046-20723068 CTGGCTGAGGAAAGGGTCACAGG + Intergenic
1038810840 8:30841000-30841022 TTGCCTGAGCACAGGGGCGGAGG - Intronic
1043860957 8:85316657-85316679 CTGACTGTGCAAAGGCACTGAGG + Intergenic
1049238132 8:141522981-141523003 CTTGCTGAGCAGAGGGGCTGGGG + Intergenic
1050690415 9:8221295-8221317 CTGGCTGGACAAAGGGATGTGGG + Intergenic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1055042795 9:71893532-71893554 ATGGCTGAGCACATGGAGGGTGG - Intronic
1056959671 9:91112104-91112126 CTGGCAGAGCACAGGGACCAGGG + Intergenic
1059982806 9:119791918-119791940 TTGACTGAGCAAAGGCAAGGAGG + Intergenic
1060766461 9:126297855-126297877 GTGGCTGAGCAGAGGGCGGGTGG - Intergenic
1060815991 9:126635436-126635458 CTGCCTGGGCAAAGGCATGGAGG + Intronic
1062084899 9:134643347-134643369 CGGGCAGAGCGATGGGACGGTGG + Intronic
1186500207 X:10044888-10044910 CTGACTGGACAAAGGGATGGGGG - Intronic
1192456550 X:71281229-71281251 TTGGCTGGGCATAGGCACGGTGG + Intergenic
1194506990 X:94745384-94745406 CTTGCTATGCAAAGGGACTGGGG + Intergenic
1199534650 X:148888798-148888820 CTGGCTGAGCAAAAGAATTGCGG + Intronic
1199981007 X:152920478-152920500 CTGGCTGATGAAAGGGTGGGTGG + Intronic