ID: 1168717585

View in Genome Browser
Species Human (GRCh38)
Location 19:58538492-58538514
Sequence GGCGCGCGGCCCCCCAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168717585_1168717593 -1 Left 1168717585 19:58538492-58538514 CCAGATCTGGGGGGCCGCGCGCC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1168717593 19:58538514-58538536 CCGGGCTGGAACAAAGGCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 207
1168717585_1168717595 3 Left 1168717585 19:58538492-58538514 CCAGATCTGGGGGGCCGCGCGCC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1168717595 19:58538518-58538540 GCTGGAACAAAGGCAGAGGCGGG 0: 1
1: 0
2: 4
3: 45
4: 512
1168717585_1168717596 4 Left 1168717585 19:58538492-58538514 CCAGATCTGGGGGGCCGCGCGCC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1168717596 19:58538519-58538541 CTGGAACAAAGGCAGAGGCGGGG 0: 1
1: 0
2: 3
3: 33
4: 300
1168717585_1168717597 18 Left 1168717585 19:58538492-58538514 CCAGATCTGGGGGGCCGCGCGCC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1168717597 19:58538533-58538555 GAGGCGGGGACAAAGCCCCGCGG 0: 1
1: 0
2: 1
3: 23
4: 187
1168717585_1168717594 2 Left 1168717585 19:58538492-58538514 CCAGATCTGGGGGGCCGCGCGCC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1168717594 19:58538517-58538539 GGCTGGAACAAAGGCAGAGGCGG 0: 1
1: 2
2: 4
3: 66
4: 503
1168717585_1168717590 -7 Left 1168717585 19:58538492-58538514 CCAGATCTGGGGGGCCGCGCGCC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1168717590 19:58538508-58538530 GCGCGCCCGGGCTGGAACAAAGG 0: 1
1: 0
2: 1
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168717585 Original CRISPR GGCGCGCGGCCCCCCAGATC TGG (reversed) Intronic
902410645 1:16209873-16209895 GGCGGGCCACCACCCAGATCAGG + Intronic
905125889 1:35716060-35716082 GGTGCGCAGCCCCCCAGAGGGGG - Exonic
905418178 1:37819102-37819124 GGAGGGCGGCCCTCCAGATGTGG + Intronic
906218816 1:44061206-44061228 GCCTCGGGGCCCCTCAGATCAGG + Intergenic
906659941 1:47574932-47574954 GACGCACGGCCCCCCAGACTGGG - Intergenic
907540951 1:55215164-55215186 GCCGCGCGGCCCGCCAGGCCCGG - Intergenic
915564381 1:156705674-156705696 GGCGCAGGGCCCCCCAGGTGGGG - Intronic
922586583 1:226738212-226738234 CGCGGGCGCCCTCCCAGATCCGG - Intronic
924188213 1:241519241-241519263 GGCGCGCAGGCCCCCAGCCCCGG - Intronic
1063449928 10:6144683-6144705 GGCCCGCAGCCCCCCAGACGCGG - Intergenic
1063817641 10:9794470-9794492 GGCGGGCGGCTCACAAGATCAGG - Intergenic
1065069144 10:22003829-22003851 GACGCCTGGCGCCCCAGATCTGG + Intergenic
1077174407 11:1182096-1182118 GGCGGGCGGCCCCCAAGTGCGGG + Intronic
1078221978 11:9359172-9359194 GGCGGGCGGCTCACCAGGTCAGG - Intergenic
1079967341 11:26994885-26994907 GGCGGGAGTCCCACCAGATCGGG + Exonic
1084590986 11:70090234-70090256 GGCGGGCGGACCACGAGATCAGG - Intronic
1084795255 11:71500992-71501014 GGGGCGGGCTCCCCCAGATCAGG + Intronic
1088814233 11:113410488-113410510 GGGGCTGGGCCCCCCAGCTCAGG - Exonic
1090768431 11:129896713-129896735 GGCGGGCGGATCCCGAGATCAGG + Intergenic
1096254995 12:50057514-50057536 TGCGCGCGGGGCCCCGGATCCGG - Intergenic
1097195215 12:57239233-57239255 GCCGAGCGGCCCCCAAGCTCGGG + Intronic
1101931288 12:109016235-109016257 GGCCCGAGGCCACCCAGATAGGG + Intronic
1102290771 12:111697811-111697833 GGCGGGCGGACCACCAGATCAGG - Intronic
1103393212 12:120589119-120589141 GGCGGGCGGCCTCCCAGTTCGGG + Intergenic
1103545770 12:121700149-121700171 GGCGGGCGGACCCCGAGGTCAGG - Intergenic
1110705256 13:78596818-78596840 GGCGCGCGGCCGCCCCGCTCGGG - Intergenic
1112344082 13:98576486-98576508 GGCGCCCGCACCCCCACATCCGG + Intronic
1115850734 14:37588144-37588166 GGGGCGCGGCGCCCCAGCCCGGG + Intergenic
1117309831 14:54510137-54510159 GGCCCGCGGCCCTCCGGCTCCGG - Intronic
1118280495 14:64423954-64423976 GGCGGGCGGATCACCAGATCAGG - Intronic
1118573582 14:67219024-67219046 GGCCAGTGGCCCCCCAGAGCAGG + Intronic
1120788005 14:88554669-88554691 GGCGCGCGGCCCCGAGGATGCGG - Exonic
1121728617 14:96171078-96171100 GCCCCCAGGCCCCCCAGATCTGG + Intergenic
1132766901 16:1539000-1539022 GCCACGCGGCCCCCCACCTCAGG + Intronic
1132789487 16:1677924-1677946 GGCGCGCGGCCCTGAAGAACAGG - Intronic
1132849846 16:2020076-2020098 AGCGCGCGGCGCCACAGATAGGG - Exonic
1132897839 16:2237325-2237347 GGCGCGCGGGGCCGCAGGTCGGG + Intronic
1133784441 16:8963617-8963639 GGCCCGCGGCCCCGCAGCCCCGG - Intronic
1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG + Intronic
1144576808 17:16434803-16434825 GGGGCGTGGCCCCCCAAATTGGG - Intronic
1146312286 17:31778744-31778766 GGCTCATGGCCCCCCAGAGCTGG + Intergenic
1148782399 17:50129500-50129522 GGCGCCCGGCCCCTCACCTCCGG + Exonic
1152356497 17:79810116-79810138 GGCGCGCGGGCCCCGGGAGCCGG - Intergenic
1158245119 18:55423781-55423803 GGGGCGCAGCGCCCCAGATGAGG - Intronic
1161321571 19:3643954-3643976 GGCAGGCGGCCCTGCAGATCCGG + Intronic
1162911024 19:13847775-13847797 AGCGCGCGGCCCGCCAGATGTGG - Intergenic
1163799610 19:19356643-19356665 GGCCCCCCGCCCCCGAGATCTGG + Exonic
1165311282 19:35030649-35030671 GGGGCGCGGCCCCCCCGCTCCGG - Intergenic
1165832726 19:38737253-38737275 GGCGTGCGGCCCCCCCGCGCTGG + Exonic
1167313864 19:48752796-48752818 GGCCCACCGCTCCCCAGATCGGG + Exonic
1167354363 19:48994060-48994082 GAAGCTCGGCCACCCAGATCTGG + Intronic
1168717585 19:58538492-58538514 GGCGCGCGGCCCCCCAGATCTGG - Intronic
946029864 2:216695253-216695275 GGTGCGCGGCGCCGCAGAACAGG + Exonic
1171123056 20:22582218-22582240 GGCGCTGAGCCCCCCAGAGCCGG - Exonic
1176039683 20:63058857-63058879 GGCTTGAGGCCCCCCAGTTCAGG + Intergenic
1177748761 21:25253894-25253916 GGCGGGCGGACCACGAGATCAGG + Intergenic
1181665270 22:24391102-24391124 GGCGGGCGGATCCCAAGATCAGG - Intronic
1181935509 22:26435600-26435622 GGCTCGGGGGCCCCCAGCTCCGG - Intronic
1182444063 22:30380109-30380131 AGCGCAGGGCCTCCCAGATCCGG - Exonic
1184562023 22:45268921-45268943 GGCCCGCGGCCTCCACGATCCGG - Intergenic
966407464 3:179612703-179612725 GGCGGGCGGCTCACGAGATCAGG - Intronic
968674596 4:1870951-1870973 GGCGCGCGGCCCGCCCGCGCGGG - Intergenic
969344698 4:6563520-6563542 GGCGCCCGGCCCCGCCGCTCCGG - Intronic
970887998 4:21008751-21008773 GGCGGGCGGATCACCAGATCAGG - Intronic
985903001 5:2811645-2811667 GGCTTGCAGCCCCCCAGACCAGG + Intergenic
992089302 5:73303423-73303445 GGCGCGGGGCCTCGGAGATCTGG + Intergenic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
993162124 5:84305648-84305670 GACGCGCGGCTCACAAGATCAGG + Intronic
1001187161 5:169585195-169585217 TACGCGCTGCCCCCCAGATTAGG + Intronic
1003191693 6:3880376-3880398 GGCGGGCGGATCACCAGATCAGG - Intergenic
1010347170 6:74825367-74825389 GGCGGGCGGATCACCAGATCAGG + Intergenic
1011870433 6:91886117-91886139 AGCAGGGGGCCCCCCAGATCTGG - Intergenic
1015404337 6:132820376-132820398 GGCGGGCGGCTCACGAGATCAGG + Intergenic
1017488693 6:154925383-154925405 GGCTCGCGCCACCCCAGATCGGG - Intronic
1019305587 7:332926-332948 GGAGCGGGGCCCCCCAGCCCTGG + Intergenic
1020192279 7:6009385-6009407 GGCGCGCCGCCCCCGTGATAGGG - Exonic
1029375004 7:100171895-100171917 GGAGTGCGGCCCCCCCGACCCGG - Exonic
1033098418 7:138450354-138450376 GGCGGGCGGATCACCAGATCAGG - Intergenic
1034249549 7:149677158-149677180 GGCGGGCGGCTCCCAAGATGGGG - Intergenic
1034418766 7:150978327-150978349 GGCGCGCGCCCCTCCGGCTCCGG + Intergenic
1035535376 8:386879-386901 GGCGGGCGGACCACCAGGTCAGG + Intergenic
1035737476 8:1898822-1898844 GCCCCGCGGCCCCCCAGTGCTGG - Intronic
1043019605 8:74984386-74984408 GGCCAGAGGCCCGCCAGATCCGG - Intergenic
1062434150 9:136539077-136539099 GGTGCGGGGACCCCCAGATGCGG - Intronic
1185689878 X:2145518-2145540 GGCGGGCGGATCACCAGATCAGG + Intergenic