ID: 1168717908

View in Genome Browser
Species Human (GRCh38)
Location 19:58539842-58539864
Sequence CTCTGTCTGAGGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168717908_1168717918 15 Left 1168717908 19:58539842-58539864 CCTGCTTCCCTCCTCAGACAGAG No data
Right 1168717918 19:58539880-58539902 AGACCCTCTTTCCCTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168717908 Original CRISPR CTCTGTCTGAGGAGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr