ID: 1168717934

View in Genome Browser
Species Human (GRCh38)
Location 19:58539955-58539977
Sequence AGACTCTGCTTCCCTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168717923_1168717934 24 Left 1168717923 19:58539908-58539930 CCCCACACAAACCCTACTTTCCT No data
Right 1168717934 19:58539955-58539977 AGACTCTGCTTCCCTGAGACAGG No data
1168717930_1168717934 1 Left 1168717930 19:58539931-58539953 CCTCAGACAGGATTCTCCCCACA No data
Right 1168717934 19:58539955-58539977 AGACTCTGCTTCCCTGAGACAGG No data
1168717926_1168717934 13 Left 1168717926 19:58539919-58539941 CCCTACTTTCCTCCTCAGACAGG No data
Right 1168717934 19:58539955-58539977 AGACTCTGCTTCCCTGAGACAGG No data
1168717928_1168717934 12 Left 1168717928 19:58539920-58539942 CCTACTTTCCTCCTCAGACAGGA No data
Right 1168717934 19:58539955-58539977 AGACTCTGCTTCCCTGAGACAGG No data
1168717925_1168717934 22 Left 1168717925 19:58539910-58539932 CCACACAAACCCTACTTTCCTCC No data
Right 1168717934 19:58539955-58539977 AGACTCTGCTTCCCTGAGACAGG No data
1168717924_1168717934 23 Left 1168717924 19:58539909-58539931 CCCACACAAACCCTACTTTCCTC No data
Right 1168717934 19:58539955-58539977 AGACTCTGCTTCCCTGAGACAGG No data
1168717929_1168717934 4 Left 1168717929 19:58539928-58539950 CCTCCTCAGACAGGATTCTCCCC No data
Right 1168717934 19:58539955-58539977 AGACTCTGCTTCCCTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168717934 Original CRISPR AGACTCTGCTTCCCTGAGAC AGG Intergenic
No off target data available for this crispr