ID: 1168720415

View in Genome Browser
Species Human (GRCh38)
Location 19:58551684-58551706
Sequence GGTCTGCATCAGCATCAGCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 1, 2: 5, 3: 31, 4: 383}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168720409_1168720415 6 Left 1168720409 19:58551655-58551677 CCTCCGCAGGTTCTTAAGCCGTT 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1168720415 19:58551684-58551706 GGTCTGCATCAGCATCAGCTAGG 0: 1
1: 1
2: 5
3: 31
4: 383
1168720410_1168720415 3 Left 1168720410 19:58551658-58551680 CCGCAGGTTCTTAAGCCGTTCCT 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1168720415 19:58551684-58551706 GGTCTGCATCAGCATCAGCTAGG 0: 1
1: 1
2: 5
3: 31
4: 383
1168720408_1168720415 7 Left 1168720408 19:58551654-58551676 CCCTCCGCAGGTTCTTAAGCCGT 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1168720415 19:58551684-58551706 GGTCTGCATCAGCATCAGCTAGG 0: 1
1: 1
2: 5
3: 31
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168720415 Original CRISPR GGTCTGCATCAGCATCAGCT AGG Exonic