ID: 1168720415

View in Genome Browser
Species Human (GRCh38)
Location 19:58551684-58551706
Sequence GGTCTGCATCAGCATCAGCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 1, 2: 5, 3: 31, 4: 383}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168720408_1168720415 7 Left 1168720408 19:58551654-58551676 CCCTCCGCAGGTTCTTAAGCCGT 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1168720415 19:58551684-58551706 GGTCTGCATCAGCATCAGCTAGG 0: 1
1: 1
2: 5
3: 31
4: 383
1168720410_1168720415 3 Left 1168720410 19:58551658-58551680 CCGCAGGTTCTTAAGCCGTTCCT 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1168720415 19:58551684-58551706 GGTCTGCATCAGCATCAGCTAGG 0: 1
1: 1
2: 5
3: 31
4: 383
1168720409_1168720415 6 Left 1168720409 19:58551655-58551677 CCTCCGCAGGTTCTTAAGCCGTT 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1168720415 19:58551684-58551706 GGTCTGCATCAGCATCAGCTAGG 0: 1
1: 1
2: 5
3: 31
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168720415 Original CRISPR GGTCTGCATCAGCATCAGCT AGG Exonic
900394954 1:2449597-2449619 GGTCTGCAGCAGCCTCTGCCTGG + Intronic
900700485 1:4045620-4045642 GGTCTGCTTCAGCCTGACCTCGG - Intergenic
900925707 1:5704989-5705011 CCCCAGCATCAGCATCAGCTGGG + Intergenic
902405494 1:16181259-16181281 CATGTGCATCAGAATCAGCTGGG - Intergenic
902636664 1:17739260-17739282 GAGCTGCATCACAATCAGCTAGG + Intergenic
902720338 1:18300147-18300169 TGCCTGCATCAGGATCACCTTGG + Intronic
902752402 1:18526205-18526227 GTGCTGTATCAGCATCAACTGGG - Intergenic
903273149 1:22204630-22204652 GGCCAGCAACAGCATCAGCCAGG - Intergenic
903300048 1:22372342-22372364 CGGCAGCATCAGCATCACCTGGG + Intergenic
903343002 1:22666250-22666272 TGGCTGCATCAGAATCACCTGGG - Intergenic
903358211 1:22761053-22761075 TGGCAGCATCAGCATCACCTGGG + Intronic
903488637 1:23710485-23710507 GATCAGCCTCAGCATCACCTGGG - Intergenic
903627808 1:24744190-24744212 AGTGTGCATCAGAATCACCTAGG - Intergenic
903762943 1:25711978-25712000 GGTCTGCATCAGGATGAGCAGGG - Intronic
906323835 1:44832253-44832275 GGTCTGTATCAGCATCTGAGAGG + Exonic
909110463 1:71470168-71470190 AGAATGCATCAGCATCACCTGGG + Intronic
910213816 1:84821512-84821534 AGTCTGCATCAAAATCATCTGGG + Intronic
910245566 1:85134826-85134848 AAGCTGCATCATCATCAGCTTGG + Intergenic
910260248 1:85287268-85287290 GATCTGCATTAGAATCAACTGGG - Intergenic
910806582 1:91194373-91194395 GGTTGGCATCAGCAGCACCTGGG + Intergenic
911738690 1:101364040-101364062 GCTATGCATCAGAATCACCTGGG + Intergenic
912963296 1:114215291-114215313 CGCCTGCATCAGAATCATCTGGG - Intergenic
913206410 1:116543269-116543291 TGTCAGCATCAGCATCATCAAGG + Intronic
913505952 1:119516391-119516413 GATCAGCACCAGCATCAGCATGG + Intergenic
915532179 1:156509026-156509048 GGGTGGCATCACCATCAGCTGGG + Intergenic
916930562 1:169574258-169574280 TCTCTGCATCAGAATCACCTAGG + Intronic
917045174 1:170851770-170851792 AGTGTGCATCAGAATCACCTAGG + Intergenic
919935342 1:202247160-202247182 GCTGTGCATCAGAATCACCTGGG - Intronic
920683269 1:208089588-208089610 CGGCAGCATCAGCATCACCTGGG - Intronic
920690570 1:208143409-208143431 TAACAGCATCAGCATCAGCTGGG - Intronic
921477882 1:215632300-215632322 TATCTGCATCAGCATCACATAGG - Intronic
921703446 1:218292499-218292521 TGTCTCCTTCAGCCTCAGCTAGG + Intronic
922055855 1:222041867-222041889 GGACGGCATCAGCACCAGCCTGG + Intergenic
923032649 1:230262449-230262471 GGTGTGCAGCAGCTCCAGCTGGG - Intronic
923701952 1:236308633-236308655 GGAGTGCAGCAGCATCATCTCGG + Intergenic
923920544 1:238559669-238559691 TGTCTGCTTCAGCACCACCTGGG - Intergenic
924446452 1:244137033-244137055 AGTCTGCATCTCCACCAGCTTGG - Intergenic
1064742562 10:18448652-18448674 CAACTGCATCAGCATCACCTGGG - Intronic
1065724699 10:28658290-28658312 TGGCAGCATCAGCATCACCTGGG + Intergenic
1065845230 10:29737469-29737491 CGGCTGCCTCAGCATCACCTGGG - Intergenic
1067220382 10:44339864-44339886 CGGCAGCATCAGCATCACCTGGG - Intergenic
1067696693 10:48541087-48541109 CAGCTGCATCAGCATCACCTGGG - Intronic
1068515158 10:58016863-58016885 CATTTGAATCAGCATCAGCTGGG - Intergenic
1070053760 10:72914378-72914400 GGCCTGCATCTGGATCAGCACGG + Intronic
1070920025 10:80178732-80178754 AGGCAGCATCAGCATCACCTGGG - Intronic
1070956710 10:80468592-80468614 GGGCAGCATGAGCATCACCTGGG + Intronic
1071786342 10:88904378-88904400 TGGCAGCATCAGCATCAACTGGG - Intronic
1072242442 10:93509418-93509440 GGCCAGCAGCAGCAGCAGCTAGG - Intronic
1072337635 10:94412989-94413011 CGCCTGCATCAGAATCACCTGGG - Intronic
1073619161 10:105029095-105029117 CCTCTGCATTAGAATCAGCTGGG + Intronic
1073641893 10:105261413-105261435 GAACAGCATCAGCATCACCTGGG + Intronic
1073947071 10:108763486-108763508 AGTCTTCTTCATCATCAGCTGGG - Intergenic
1074106896 10:110395410-110395432 GAGCTGCATCAGCATCCCCTGGG - Intergenic
1074610637 10:115017703-115017725 GGCCACCATCAGCATCAGCCTGG + Intergenic
1074757297 10:116633392-116633414 GGTCTGCAGCAGCATTGGATGGG + Intronic
1074931728 10:118133086-118133108 GACCAGCATCAGCATCACCTGGG + Intergenic
1075212797 10:120505293-120505315 GGGCTTCATTAGCATCAGCAAGG - Intronic
1076302174 10:129436710-129436732 GTTCAGCATCAGCCTCATCTAGG + Intergenic
1077561371 11:3263735-3263757 GCTCTGCCTCTCCATCAGCTTGG - Intergenic
1077567267 11:3309564-3309586 GCTCTGCCTCTCCATCAGCTTGG - Intergenic
1078994895 11:16687072-16687094 GGAGTGCATCAGCATGATCTTGG - Intronic
1079219873 11:18550930-18550952 GCTGTGCATCAGAATCATCTGGG - Intronic
1080823866 11:35831624-35831646 GTTATGCTTGAGCATCAGCTAGG - Intergenic
1081793852 11:45806274-45806296 GGTCTGCTTGAGCAGCAGGTAGG - Exonic
1081932966 11:46885349-46885371 TGGCAGCATCAGCATCATCTGGG - Intronic
1082960626 11:58915656-58915678 ATTCTGCATCAGAATCACCTGGG - Intronic
1082980561 11:59116804-59116826 ATTCTGCATCAGAATCACCTGGG - Intronic
1085045926 11:73353316-73353338 GGTCAGCGTCCGCACCAGCTTGG - Intronic
1086204325 11:84239845-84239867 GATCTGCTTCAGCATCCCCTGGG + Intronic
1087851937 11:103041693-103041715 TGTCTGTATCAGAATCACCTGGG - Intergenic
1088987793 11:114925522-114925544 GGTCTGGCTCAGCATAATCTGGG - Intergenic
1089353888 11:117837390-117837412 AGTCTGCATCTGGATGAGCTGGG + Exonic
1089375032 11:117988120-117988142 GGTAGGCATCAGACTCAGCTTGG + Intronic
1091980068 12:4857592-4857614 CCTATGCATCAGCATCACCTGGG - Intergenic
1092146375 12:6217547-6217569 GGTGGGCATCAGAATCATCTGGG - Intronic
1093063017 12:14627247-14627269 GGCCTGCATCATCATCCCCTGGG + Intronic
1093187738 12:16041041-16041063 GCACAGCATCAGCATCACCTGGG - Intergenic
1093818346 12:23578413-23578435 AGTGTGCATCAGAATCACCTGGG - Intronic
1096420380 12:51452275-51452297 GGCCTGCATCAAGATCTGCTTGG + Intronic
1097861987 12:64527125-64527147 GGACAGCATGAGCTTCAGCTGGG - Intergenic
1097906032 12:64920464-64920486 GAGCTGTATCAGCATCACCTGGG - Intergenic
1098089669 12:66887927-66887949 GGTGTGCATCAAAATCATCTAGG + Intergenic
1098202360 12:68069227-68069249 AGCCTGGAGCAGCATCAGCTGGG - Intergenic
1100092867 12:90992863-90992885 TGGCAGCATCAGCATCACCTGGG - Intronic
1100666479 12:96758861-96758883 CGGCGGCATCAGCATCACCTGGG - Intronic
1100706180 12:97202863-97202885 GGTCTGCATCAAAATTACCTGGG - Intergenic
1102066595 12:109981498-109981520 TGGCTGCATCAGCATCACCTAGG - Intronic
1102075117 12:110053519-110053541 GCTATGCATTAGAATCAGCTGGG - Intronic
1102209116 12:111111678-111111700 AGGCAGCATCAGCATCACCTGGG - Intronic
1102223477 12:111210879-111210901 GCTCTGCGTCTCCATCAGCTGGG - Intronic
1102676497 12:114663118-114663140 TGTCTGCCTCATCAGCAGCTGGG - Intergenic
1102757155 12:115351061-115351083 TGGCTGCATCAGCCTCATCTGGG - Intergenic
1103335686 12:120187802-120187824 AGGCAGCATCAGCATCATCTTGG - Intronic
1104205711 12:126636382-126636404 CATCAGCATCAGCATCAACTGGG - Intergenic
1105048894 12:133030041-133030063 GGCCTGCATTGGCATCATCTGGG - Intergenic
1106032145 13:26013191-26013213 GGCCTGGATCTGCCTCAGCTGGG - Intronic
1106473078 13:30075417-30075439 CGGCTGCATCAGCATCACCTGGG + Intergenic
1108680435 13:52775615-52775637 TGGCAGCATCAGCATCACCTGGG + Intergenic
1110589543 13:77239522-77239544 CTTCTGCATCAGAATCACCTGGG - Intronic
1110779830 13:79452003-79452025 GTTCTGCACCAGCTTGAGCTGGG - Intergenic
1111460882 13:88540304-88540326 GAGCTGCATCAGCCACAGCTGGG - Intergenic
1114297286 14:21341356-21341378 ATTCTGCATCAGAATCATCTGGG - Intronic
1114341186 14:21746259-21746281 CATCAGCATCAGCATCACCTTGG + Intergenic
1116037484 14:39645084-39645106 TTTCTGCCTCAGCCTCAGCTGGG + Intergenic
1116857077 14:49962082-49962104 AGTGTTCATCAGGATCAGCTTGG + Intergenic
1116912298 14:50482088-50482110 GGTGTGCATCAGCATCAAAGTGG + Intronic
1117032480 14:51688042-51688064 TGGCTGCATCAGAATCACCTGGG - Intronic
1119018902 14:71089099-71089121 CGTGTGCATCAGAATCACCTGGG - Intronic
1119166416 14:72498691-72498713 GCTGTGCATCAGAATCACCTGGG + Intronic
1119363556 14:74071911-74071933 CATCTCCTTCAGCATCAGCTAGG + Exonic
1119471293 14:74901383-74901405 GGTCTGGATCAGCATCATCTGGG + Intronic
1119977926 14:79045896-79045918 GTTTTGCATCAGCATCACTTGGG - Intronic
1119989384 14:79178197-79178219 AGTGTGCATCAGTATCACCTGGG - Intronic
1120529864 14:85619138-85619160 GGACTGCAACAGCATGATCTTGG + Intronic
1120726008 14:87942242-87942264 GAGCAGCATCAGCATCACCTGGG - Intronic
1121000915 14:90451571-90451593 TTTCTGCAGAAGCATCAGCTGGG - Intergenic
1121247163 14:92470132-92470154 TGTCAGCATCAGCAGCACCTGGG + Intronic
1121625558 14:95383324-95383346 TGGCTGCATCAGAATCACCTTGG + Intergenic
1121702303 14:95963741-95963763 CGGCAGCATCAGCATCATCTGGG - Intergenic
1122165118 14:99817470-99817492 GGGCTGCCTCAGCACCAGCCGGG - Intronic
1122618539 14:103038575-103038597 GGAGTGCAGCAGCATGAGCTCGG + Intronic
1123415906 15:20095056-20095078 GGACTGCATGAGCAACGGCTTGG + Intergenic
1123525246 15:21102170-21102192 GGACTGCATGAGCAACGGCTTGG + Intergenic
1123663954 15:22591904-22591926 TGGCTGCATCAGAATCACCTGGG + Intergenic
1124090299 15:26593088-26593110 GACCAGCATCAGCATCACCTGGG - Intronic
1124252805 15:28117888-28117910 GCTGTGCATCAGAATCATCTGGG + Intronic
1124317784 15:28686345-28686367 TGGCTGCATCAGAATCACCTGGG + Intergenic
1124565654 15:30811143-30811165 TGGCTGCATCAGAATCACCTGGG - Intergenic
1125005436 15:34811514-34811536 CTTCAGCATCAGCATCATCTGGG - Intergenic
1126372597 15:47963098-47963120 TGGCAGCATCAGCATTAGCTGGG - Intergenic
1126415255 15:48411641-48411663 AAGCTGCATCAGCATCACCTGGG + Intronic
1126915326 15:53460012-53460034 CATGTGCATCAGCAGCAGCTAGG + Intergenic
1129176816 15:73846261-73846283 CGACAGCATCAGCATCACCTTGG - Intergenic
1129914782 15:79259248-79259270 TCCCTGCATCAGCATCACCTGGG + Intergenic
1130226575 15:82063289-82063311 GGTGTGCAGCAGCATCACCTGGG - Intergenic
1130958765 15:88645812-88645834 GATGTGCATCAGCAACAGCAAGG - Intronic
1131482769 15:92795970-92795992 TGTTTGTATCAGCAGCAGCTGGG + Intronic
1131807426 15:96137129-96137151 GGGCGGCAGCAGCATCACCTGGG + Intergenic
1132231792 15:100189922-100189944 TGCCTGCATCAGCATCACCGGGG + Intronic
1133658925 16:7895900-7895922 GGGGTACATCAGCATCACCTGGG - Intergenic
1133864805 16:9632715-9632737 AGGCAGCATCAGCATCACCTGGG - Intergenic
1134296641 16:12952080-12952102 CGTCTGCATTAGCAAAAGCTGGG - Intronic
1135027320 16:19008459-19008481 GGTCTGGAGCGGCCTCAGCTGGG + Intronic
1135272392 16:21080690-21080712 CTGCTGCATCAGCGTCAGCTAGG - Intronic
1135295203 16:21273586-21273608 GCTATGCAGCAGCATTAGCTAGG - Intronic
1135587412 16:23681334-23681356 GGGCAGCATCACCATCATCTGGG + Intronic
1135688936 16:24520890-24520912 GGTCTGCATCAGAATCACCTGGG + Intergenic
1135949031 16:26895650-26895672 GGAGTGCATCAGCATGATCTTGG + Intergenic
1137922156 16:52501174-52501196 TGTCTGCATCATCATCATGTAGG - Intronic
1139282102 16:65779950-65779972 GGAGTGCAGCAGCATCATCTCGG + Intergenic
1140446131 16:75029651-75029673 GCTCAGCCTCAGCCTCAGCTGGG - Intronic
1140999831 16:80297848-80297870 TGGCTGCATCAGAATCACCTGGG - Intergenic
1141130854 16:81435607-81435629 GGTTTCCATCATCTTCAGCTGGG - Intergenic
1141570851 16:84932818-84932840 GGCCTCCAGCAGCATCTGCTAGG - Intergenic
1143378010 17:6478690-6478712 GGGCTGCCTCAGCAGCAGCCAGG - Exonic
1144009746 17:11135684-11135706 GCCCTGCATCAGAATCAGTTTGG + Intergenic
1144720548 17:17466618-17466640 GATCTCCAGCAGCAGCAGCTAGG + Intergenic
1144791558 17:17862425-17862447 TGTCTGCAGCAGCAGCAGCATGG + Intronic
1145202497 17:20959213-20959235 GGTCTGTTTCACCATCATCTGGG - Intergenic
1145214750 17:21043025-21043047 GGTCCGCAGCAGCCGCAGCTCGG - Exonic
1145802754 17:27700263-27700285 GGTCCTCCTCAGCATCAACTTGG - Intergenic
1146632804 17:34483068-34483090 GGGCTGCATCAGCAGCTGCCTGG - Intergenic
1146771142 17:35569621-35569643 TATCTGCTTCATCATCAGCTGGG - Intergenic
1147433671 17:40392646-40392668 GGTCTGATTCAGAATCAGATAGG - Exonic
1148445048 17:47732621-47732643 GCACTGCATCAGCAGCAGCCAGG - Intergenic
1148930702 17:51125027-51125049 GGCCTGCATCAGCACAACCTGGG - Intergenic
1148986512 17:51627276-51627298 AGTGTGCATCAGAATCATCTAGG + Intergenic
1149548858 17:57524932-57524954 CAGCTGCATCAGCATCACCTGGG + Intronic
1151624253 17:75266815-75266837 GATCTCCAGCAGCAGCAGCTGGG + Exonic
1151726026 17:75885044-75885066 CTTCTGCCTCAGCCTCAGCTGGG + Intronic
1151807620 17:76416379-76416401 GGTGTGCATCAGAATCATTTGGG - Intronic
1152830309 17:82493247-82493269 GGTCTGCCTCTGCACCAGCTAGG + Intergenic
1152990615 18:360515-360537 CATCAGCATCAGCATCACCTGGG - Intronic
1155528702 18:26743918-26743940 CGGCAGCATCAGCATCAGCAGGG - Intergenic
1157194557 18:45610254-45610276 GTTCAGCATCAGCTTCACCTGGG - Intronic
1157210395 18:45737129-45737151 GGTAGGCATCAGAATCACCTGGG + Intronic
1157326587 18:46673583-46673605 GGCCTGCATCAGAATCACCTGGG - Intronic
1157590645 18:48834579-48834601 TGACGGCATCAGCATCACCTGGG - Intronic
1157678135 18:49582731-49582753 GGTCAGCAGCTGGATCAGCTGGG + Intronic
1158015025 18:52774133-52774155 CAGCTGCATCAGCATCATCTGGG + Intronic
1158613092 18:58961217-58961239 CATCAGCATCAGCATCAGCTAGG - Intronic
1159072626 18:63642923-63642945 GGTCTGGATCAGGATAGGCTGGG - Intronic
1159074067 18:63660562-63660584 GGTCTGGATCAGGATAGGCTAGG - Intronic
1160084536 18:75763507-75763529 GGTCTCCAGCAGCATGAGCCAGG - Intergenic
1162252779 19:9460205-9460227 GGTCATCCTCAGCATCAACTTGG - Intergenic
1163125113 19:15240327-15240349 TGTGTGCATCAGAATCATCTGGG + Intronic
1163393500 19:17045037-17045059 GGACTGCATCAACATCATCCTGG - Intergenic
1163688878 19:18727679-18727701 GGTCAGCAGCCGCAACAGCTGGG + Intronic
1166403769 19:42504436-42504458 GGTATGCATCAGAATTACCTAGG - Intergenic
1167226995 19:48251805-48251827 GGTCTGGACCAGCATCAACATGG + Intronic
1168720415 19:58551684-58551706 GGTCTGCATCAGCATCAGCTAGG + Exonic
925887970 2:8410077-8410099 GGTCTGGATCAGCAGTGGCTGGG + Intergenic
927142479 2:20139823-20139845 GGTCTTAATTGGCATCAGCTAGG - Intergenic
927923240 2:26990190-26990212 GGTCTGCATCAAAATCACTTGGG - Intronic
927989972 2:27441122-27441144 GCACTGCATCAGCACCACCTAGG - Exonic
928188941 2:29143726-29143748 GGTCTGGAACAACATCAGCAGGG - Exonic
928590459 2:32809458-32809480 CGTCAACATCAGCATCACCTGGG + Intronic
929026698 2:37611707-37611729 CAGCAGCATCAGCATCAGCTGGG + Intergenic
929426968 2:41853671-41853693 GATCAGCATCAGCATCACCTGGG - Intergenic
930341266 2:50118289-50118311 TGGCGGCATCAGCATCACCTGGG - Intronic
930712811 2:54565028-54565050 GGTCAGCATCAGCATCATCTGGG + Intronic
931792040 2:65672249-65672271 TGGCAGCATCAGCATCACCTGGG + Intergenic
932588834 2:73050501-73050523 GGTCTGCCTGAGCCACAGCTGGG + Intronic
934725029 2:96610976-96610998 AGTCAGCCTCAGCATCAGCTTGG + Intronic
935194877 2:100807333-100807355 GGTCAGCACCAGAATCACCTGGG - Intergenic
935439488 2:103075739-103075761 CCACTGCATCAGCATCACCTGGG + Intergenic
935698456 2:105789846-105789868 GGCCAGCACCAGCATCACCTGGG - Intronic
935788996 2:106573903-106573925 TGACAGCATCAGCATCATCTAGG + Intergenic
937590732 2:123610274-123610296 GGTGTGCAGCAGCATGATCTGGG - Intergenic
938418692 2:131125868-131125890 GGACTGCATCAACATCCGCACGG + Exonic
938673460 2:133606667-133606689 GGTGTGCATCAGGATCTCCTGGG - Intergenic
940061919 2:149580925-149580947 GATCTGCATCAGTATCATTTAGG - Intronic
940892605 2:159049463-159049485 GGACTGCTTCATCATCAGCAGGG + Intronic
941222560 2:162802015-162802037 AGTGTGCATCAGAATCACCTAGG + Intronic
943394640 2:187318746-187318768 CATCAGCATCAGCATCACCTGGG + Intergenic
943425802 2:187732132-187732154 GATCTGCAGCAGCAGCAGCAGGG + Intergenic
943488608 2:188520418-188520440 CTTCTGCCTCAGCCTCAGCTGGG - Intronic
945181573 2:207097063-207097085 CAGCAGCATCAGCATCAGCTGGG - Intronic
945255564 2:207800303-207800325 GGGCAGCATCAGCATCACCTGGG + Intergenic
945255652 2:207800909-207800931 AGTGTGTATCAGAATCAGCTGGG - Intergenic
945344684 2:208699467-208699489 CATCAGCATCAGCATCACCTGGG - Intronic
946024459 2:216663699-216663721 GGGCAGCATCAGCATCACGTTGG + Intronic
947093406 2:226539284-226539306 GATCTGCAACAGAATCACCTGGG - Intergenic
947140335 2:227014336-227014358 TGGCAGCATCAGCATCACCTGGG - Intronic
947472238 2:230410808-230410830 GGTCTCCACCAGCACCTGCTGGG - Intergenic
948052191 2:234987088-234987110 AGGCAGCATCAACATCAGCTGGG + Intronic
1168805954 20:672526-672548 GTTCTGCATCTTTATCAGCTAGG + Intronic
1169339987 20:4789413-4789435 AATCAGCATCAGCATCACCTGGG - Intronic
1169961519 20:11165400-11165422 GGGCTACATCAGAATCACCTGGG + Intergenic
1170009278 20:11703796-11703818 CAGCTGCATCAGCATCACCTGGG + Intergenic
1170037239 20:12002506-12002528 GGGGTGCATCAGGATCACCTGGG - Intergenic
1171198030 20:23216512-23216534 CATCAGCATCAGCATCAGCAGGG + Intergenic
1172765270 20:37347299-37347321 GGTCTGCAACAGGACCAGCCTGG - Intronic
1172817535 20:37699764-37699786 GTACAGCATCAGCATCACCTGGG - Intronic
1172946357 20:38692725-38692747 GGTCAGCATCAGCATCTCCGGGG - Intergenic
1173247042 20:41344154-41344176 CATCAGCATCAGCATCACCTGGG - Intronic
1173807578 20:45935846-45935868 GCTGTGCATCAGAATCATCTTGG - Intronic
1173816186 20:45989978-45990000 TGGCTGCATCAGAATCACCTGGG - Intergenic
1173885830 20:46458024-46458046 TGGCAGCATCAGCATCACCTGGG + Intergenic
1174422506 20:50408818-50408840 GCTGTGCATCAGAATCACCTGGG - Intergenic
1174782147 20:53399675-53399697 GGTCTCCTCCAGCATGAGCTTGG - Intronic
1175578019 20:60077335-60077357 GGAAGGCATCAGCATCACCTGGG + Intergenic
1178590899 21:33908991-33909013 GGGCGGCATCAGCATCACCTGGG - Intronic
1179058028 21:37954036-37954058 TGTCTGCATCAGAATCACCTGGG - Intronic
1180597884 22:16990935-16990957 CATCAGCATCAGCATCACCTGGG - Intronic
1182323169 22:29491537-29491559 TGTCTTCAGCAGCATCACCTGGG + Intergenic
1182443969 22:30379739-30379761 GGTCTGCTGGAGCATCAGCCAGG + Exonic
1182543786 22:31060923-31060945 GGACTGCATGAGCAGCGGCTTGG - Intergenic
1183050880 22:35259692-35259714 GGACTGTATCAGCCACAGCTTGG - Intronic
949355151 3:3172599-3172621 GCTATGCATCAGAATCACCTGGG - Intronic
949748639 3:7325477-7325499 CAGCTGCATCAGCATCACCTGGG - Intronic
949766823 3:7535920-7535942 GGTCTGCATCTGCGTAAGGTGGG + Intronic
949892802 3:8745825-8745847 GGTCTGCAGCAGCATCAAGGTGG + Exonic
950196090 3:11010312-11010334 AGACAGCATCAGCATCACCTGGG - Intronic
950258439 3:11525144-11525166 GTCCTGCCTCAGCCTCAGCTGGG + Intronic
950585562 3:13890024-13890046 GGTGGCCATCAGCATCACCTGGG - Intergenic
951035350 3:17926430-17926452 GCTCTGCATCAGAATCACCAGGG - Intronic
951055916 3:18146159-18146181 CGGCAGCATCAGCATCACCTGGG + Intronic
951182569 3:19676082-19676104 TTTCTGCAACAGCATGAGCTCGG - Intergenic
952742355 3:36746913-36746935 CATCAGCATCAGCATCATCTGGG - Intergenic
953256697 3:41297439-41297461 GCTCAGCATCAGCATCAGTTCGG - Intronic
955679188 3:61482673-61482695 TATTTGCATAAGCATCAGCTAGG - Intergenic
955803600 3:62710646-62710668 GCTGTGCATCAGAATCACCTGGG - Intronic
955915136 3:63900031-63900053 GGTGTGCAGCAGCATCATCATGG - Intronic
955933195 3:64078145-64078167 AGTATGCATCAGAATCACCTGGG - Intergenic
957150614 3:76481599-76481621 AGTTTGCATCAGCATCATCTGGG + Intronic
957197764 3:77092167-77092189 TGCCTGCATCAGAATCATCTGGG - Intronic
958737284 3:98024004-98024026 GGTGAGCATCAGGATCACCTGGG - Intronic
959659318 3:108848249-108848271 AATCTGCATCAGAATCACCTGGG - Intronic
960611046 3:119555011-119555033 GAGCAGCATCAGCATCACCTAGG + Intronic
960961884 3:123076788-123076810 GGTCTGGATCACCGCCAGCTTGG - Intronic
961867523 3:129964480-129964502 GGTCTCCGTCAGCACCCGCTGGG + Intergenic
961963267 3:130874896-130874918 GAGCAGCATCAGCATCACCTGGG - Intronic
961994084 3:131222726-131222748 CAGCAGCATCAGCATCAGCTGGG + Intronic
962024613 3:131534455-131534477 GGACTGCATTAGCATCACCTGGG + Exonic
962637796 3:137348824-137348846 GGTCTGCTTCTGCTTCAGGTTGG + Intergenic
962679561 3:137784259-137784281 TGTGTGCACCAGCATCAACTGGG + Intergenic
963272712 3:143301618-143301640 GGTGTGTATCAGAATCACCTGGG + Intronic
963942702 3:151110983-151111005 TCTCTGTATCAGCATCACCTGGG + Intronic
966825870 3:183964546-183964568 CATCAGCATCAGCATCATCTGGG - Intronic
967136308 3:186515658-186515680 GATCAGCATCAGCATCACCTGGG + Intergenic
969270430 4:6095993-6096015 GGCCTGCCTGAGCATCATCTAGG - Intronic
970916919 4:21346752-21346774 CGGCAGCATCAGCATCACCTGGG - Intronic
971844445 4:31900379-31900401 GCACAGCATCAGCATCACCTGGG - Intergenic
973835188 4:54802625-54802647 ACTGTGCATCAGCATCACCTGGG + Intergenic
975294112 4:72712313-72712335 GGGCTGCATCTGCATCTTCTTGG - Intergenic
976225073 4:82789511-82789533 CGCCAGCATCAGCATCACCTGGG - Intronic
976709191 4:88051012-88051034 GGTCTGAATCTGCAGCAGGTGGG - Intronic
977300793 4:95264994-95265016 GTCCTGCATCAGAATCACCTGGG + Intronic
977335243 4:95689643-95689665 GGCCTCCATCATCATCAGATGGG - Intergenic
978228130 4:106363790-106363812 CGTCTGCAACATCAACAGCTCGG + Intergenic
978228373 4:106366672-106366694 TGTCTGCATCAGAATCAACTGGG - Intergenic
978419543 4:108515767-108515789 GCTGTGCATCAGCATCACTTGGG - Intergenic
978503005 4:109428972-109428994 CATCAGCATCAGCATCACCTGGG + Intergenic
982171518 4:152666223-152666245 GCTGTGCATCAGCGTCACCTGGG + Intronic
985823433 5:2176254-2176276 CGGCAGCATCAGCATCACCTGGG - Intergenic
986804864 5:11300213-11300235 GGTCTCCAGCAGAAACAGCTAGG + Intronic
987031789 5:13983119-13983141 GGATTGCATCAGCATCAACTAGG - Intergenic
988269058 5:28991232-28991254 GGTCTGCTTCAGCACATGCTTGG - Intergenic
988645670 5:33092837-33092859 GGTCTGCATGTGCACCAGGTTGG + Intergenic
989047902 5:37290880-37290902 CATCAGCATCAGCATCACCTAGG - Exonic
989216395 5:38908398-38908420 GGTTTGTATGTGCATCAGCTGGG - Intronic
989543967 5:42650932-42650954 GGTCTTCATTAGGATAAGCTGGG + Intronic
989624055 5:43412592-43412614 GGTGTGCATCAGAATCATTTGGG + Intergenic
989960215 5:50404390-50404412 CATGTGCATCAGAATCAGCTGGG - Intronic
990140771 5:52700892-52700914 TGTATTCATCAGCATCAGTTGGG + Intergenic
991619438 5:68530431-68530453 AGCCTGCATCAGAATCACCTAGG + Intergenic
992767649 5:80015867-80015889 GGTGAGCATTAGCATCAGCCTGG + Intronic
995198472 5:109399617-109399639 AGTCTGCTTCTGCATCTGCTAGG - Intronic
995411110 5:111858213-111858235 AGTGTGCATCAGAATCACCTGGG - Intronic
995672500 5:114622564-114622586 AGTCGGCATCAGCATTAGGTGGG + Intergenic
996971703 5:129377415-129377437 TGTCTGCAACAGCCTCAACTGGG - Intergenic
997001236 5:129764628-129764650 GGTCTGCATCAGAATTAATTAGG - Intronic
997796217 5:136814005-136814027 GTCCTGGATCAGCATCAGCTGGG + Intergenic
998981520 5:147708413-147708435 GGTGTGCATCAGAATGACCTGGG - Intronic
999713825 5:154343059-154343081 GGTGTGCATAAGAATCACCTGGG + Intronic
999777163 5:154820598-154820620 CATCTGCATCAGAATAAGCTGGG + Intronic
999955646 5:156698503-156698525 GTTCTGCATTAGCAGCAGGTTGG - Intronic
1000421878 5:161047311-161047333 GGGCAGCATCAACATCACCTGGG + Intergenic
1000721063 5:164707821-164707843 CTTCAGCATCAGCATCACCTGGG + Intergenic
1001421922 5:171594027-171594049 GCTGTGCATCAGAATCACCTGGG - Intergenic
1002582129 5:180215326-180215348 GGCTTGCATCAGCTTCACCTGGG - Intergenic
1004486583 6:16072225-16072247 CATCAGCATCAGCATCACCTGGG - Intergenic
1005187276 6:23177153-23177175 GGGTTGCATCAGCAGCACCTGGG - Intergenic
1005357417 6:24997832-24997854 GAGCAGCATCAGCATCATCTGGG + Intronic
1006776507 6:36596930-36596952 GGACTGCATCAGCTGCATCTCGG - Exonic
1006985631 6:38173751-38173773 TGTCGCCATCAGCATCAGCCTGG - Exonic
1007018904 6:38498798-38498820 GGTCTGCCTCAGTATCAACTGGG - Intronic
1007218775 6:40262257-40262279 GGTCTGCATCAGAATCACCTGGG + Intergenic
1008301940 6:49851625-49851647 TGGCAGCATCAGCATCAGCTGGG + Intronic
1008794414 6:55284347-55284369 CATCGGCATCAGCATCATCTGGG + Intergenic
1010266579 6:73874804-73874826 GCTTGGCATCAGCATCTGCTTGG + Intergenic
1011507025 6:88056502-88056524 AGACTGCATCAGTATCACCTGGG + Intronic
1012438610 6:99241127-99241149 GGTATACATCAGAATCACCTAGG - Intergenic
1013068335 6:106705030-106705052 CATCAGCATCAGCATCACCTGGG + Intergenic
1013296434 6:108761908-108761930 TGACTGCATCAGTATCACCTGGG + Intergenic
1013655503 6:112242600-112242622 TGGCAGCATCAGCATCACCTGGG - Intronic
1014142579 6:117961414-117961436 AGACTGCCTGAGCATCAGCTGGG - Intronic
1015631561 6:135236874-135236896 GGTTTCCATCAGCATCAGGCAGG - Intergenic
1015888392 6:137944574-137944596 CGTCTGCATCAGTATCAGCTGGG - Intergenic
1016830722 6:148430774-148430796 CATCTGCATCAGCATCACCTGGG - Intronic
1017488890 6:154926810-154926832 GGTTTGCAACAGCATTACCTCGG + Intronic
1017727138 6:157283661-157283683 AGCCTGAATCAGAATCAGCTGGG - Intergenic
1021164042 7:17311964-17311986 AGGCAGCATCAGCATCACCTGGG + Intronic
1022590029 7:31652738-31652760 TGTCTCCTTCATCATCAGCTTGG + Intronic
1022648102 7:32250383-32250405 GGTGCGCATCAGAATCACCTGGG + Intronic
1022704350 7:32788548-32788570 GGCCTGCATCAGAATCACCAGGG + Intergenic
1028163549 7:87512361-87512383 GGTTGGCATCAGAATCACCTCGG + Intronic
1028539231 7:91924212-91924234 GGACTGCAGCAGCATGATCTCGG + Intergenic
1028675226 7:93452172-93452194 GGTCTGCATCAGCATCACCTGGG - Intronic
1029802688 7:102966224-102966246 AGCCTGCATCAGAATCATCTAGG + Intronic
1030423890 7:109347126-109347148 GCTCTACATCAGCATCATCATGG - Intergenic
1031884760 7:127234624-127234646 GAGCAGCATCAGCATCACCTGGG + Intronic
1032353855 7:131191011-131191033 GGGCAGCATCAGCGTCACCTGGG - Intronic
1032397043 7:131597897-131597919 GGAGTGCATCAGCATGATCTCGG - Intergenic
1032478944 7:132231359-132231381 GTTCTGCATCAGCTACAGTTTGG - Intronic
1033009839 7:137609301-137609323 GATCTTCATCATCATCATCTTGG + Intronic
1033272011 7:139940384-139940406 GGGCTGCATGAGAATCACCTAGG + Intronic
1033275737 7:139970431-139970453 TGGCTGTATCAGCATCACCTGGG - Intronic
1033374804 7:140748369-140748391 GGTCTGTATTAGAATCACCTGGG + Intronic
1034128466 7:148695324-148695346 GCTTTGCTTCAGAATCAGCTGGG - Intergenic
1035287142 7:157813894-157813916 GGTCACCAGCAGCATCACCTGGG - Intronic
1036138922 8:6188469-6188491 GCTCTGCATCTGCCTCATCTGGG - Intergenic
1036674335 8:10817666-10817688 GGTCAGCAGCAGTATCACCTGGG + Intronic
1037066967 8:14593845-14593867 GGTGTGTATCAGAATCACCTAGG + Intronic
1037340394 8:17838698-17838720 AGTGTGCATCAGAATCACCTGGG + Intergenic
1037536321 8:19827815-19827837 GGTCTGGACCTGCATCAGGTTGG - Intronic
1037684958 8:21130762-21130784 GGTCTGATTCACCATCTGCTGGG - Intergenic
1038195129 8:25360317-25360339 GGTCTCCATGAGCCTCTGCTTGG + Intronic
1038394683 8:27238129-27238151 GGTATGTATCAGCATGACCTAGG + Intronic
1039225800 8:35387031-35387053 TGGCAGCATCAGCATCACCTAGG + Intronic
1039236146 8:35504672-35504694 TGTATGCATCAGCATTATCTGGG + Intronic
1042505164 8:69551763-69551785 TGTCAGCATCAGCATCACCTGGG + Intronic
1042906223 8:73774844-73774866 GCTCTGGATCAGAATCAGCTGGG + Intronic
1043054568 8:75421662-75421684 AGTGGGCATCAGAATCAGCTGGG + Intronic
1043373181 8:79616579-79616601 GGTCAGAATCAGCATCATCTGGG - Intronic
1045436359 8:102168740-102168762 GGGCTGCATCAGAATCACCTGGG + Intergenic
1045470625 8:102509139-102509161 TGGCAGCATCAGCATCACCTGGG + Intergenic
1045900539 8:107274114-107274136 TTTCTGCATCAGCATCACTTTGG + Intronic
1046810356 8:118526489-118526511 TGACTGCATCAGAATCACCTGGG - Intronic
1047645527 8:126866118-126866140 CAGCAGCATCAGCATCAGCTGGG - Intergenic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1047806966 8:128371024-128371046 GGAGTGCAGCAGCATCATCTTGG + Intergenic
1048247908 8:132829586-132829608 TGACAGCATCAGCATCATCTGGG + Intronic
1050529430 9:6575406-6575428 GAGCTGCCTCAGCATCACCTGGG + Intronic
1050710263 9:8453694-8453716 AGTATGCATCAGCATCACCTGGG + Intronic
1051088469 9:13379274-13379296 AGTATGCATCAGAATCACCTGGG + Intergenic
1052055636 9:23904190-23904212 GACCTGCATCAGCATCACCTGGG + Intergenic
1052083283 9:24232974-24232996 TTTATGCATCAGCATCACCTGGG + Intergenic
1052347887 9:27428356-27428378 GATTTGCATCAGCATTACCTGGG - Intronic
1053419377 9:37967650-37967672 TGGCAGCATCAGCATCACCTGGG + Intronic
1054716635 9:68563535-68563557 CGGCAGCAGCAGCATCAGCTGGG + Intergenic
1055469451 9:76596723-76596745 TGGCAGCATCAGCATCAACTGGG - Intergenic
1056031786 9:82560882-82560904 GGTTCGCATCATCATCACCTGGG + Intergenic
1056079625 9:83078165-83078187 TATCTGCATCAGAATCACCTGGG - Intergenic
1057304094 9:93902551-93902573 GGCCTGCATCAGCACCCGGTGGG - Intergenic
1057320193 9:94005632-94005654 GCTATGCATCAGAATCACCTTGG + Intergenic
1057356421 9:94335611-94335633 CATCAGCATCAGCATCACCTGGG + Intergenic
1057651328 9:96922016-96922038 CATCAGCATCAGCATCACCTGGG - Intronic
1057831163 9:98408392-98408414 GGTCTGCATCAGGGTCACCATGG + Intronic
1057977826 9:99625193-99625215 CGGCAGCATCAGCATCACCTGGG - Intergenic
1058009964 9:99966078-99966100 TGGCAGCATCAGCATCACCTGGG + Intronic
1058291619 9:103248790-103248812 AATCTGCATCAGTATCTGCTTGG - Intergenic
1061329129 9:129881255-129881277 TGTCTTCTTTAGCATCAGCTCGG - Exonic
1187834534 X:23418012-23418034 TGGCAGCATCAGCATCAACTGGG - Intergenic
1188354629 X:29175982-29176004 AGCCTGCATCAGAATTAGCTAGG + Intronic
1188589360 X:31815122-31815144 GGCCAGCATCAGCATAACCTAGG + Intronic
1188616004 X:32159935-32159957 GATGTGCATCAGAATCACCTGGG - Intronic
1189277739 X:39798985-39799007 GAGCAGCATCAGCATCACCTGGG - Intergenic
1191044330 X:56119856-56119878 GGTCTGGATCTGCATAAGGTAGG + Intergenic
1194197182 X:90909015-90909037 AGTCAGCAGCAGCATAAGCTTGG - Intergenic
1194803276 X:98297477-98297499 AGTGTGCATCAGCATCACCTAGG - Intergenic
1195545840 X:106111684-106111706 GAGCAGCATCAGCATCACCTGGG + Intergenic
1195555131 X:106212892-106212914 AATATGCATTAGCATCAGCTAGG + Intergenic
1195682985 X:107562656-107562678 GGTCTATATCAGCATCCCCTGGG - Intronic
1195753619 X:108179991-108180013 GGCCAGCATCAGCATCACCTAGG - Intronic
1197141559 X:123122467-123122489 TGTCAGCAGCAGCAGCAGCTTGG - Intergenic
1197867165 X:131031194-131031216 GGTGTGCATCTGCATCATCTGGG - Intergenic
1198502647 X:137267315-137267337 CAGCAGCATCAGCATCAGCTGGG - Intergenic
1198635755 X:138698601-138698623 GGTTTTCATAAGCATTAGCTGGG + Intronic
1200543036 Y:4483217-4483239 AGTCAGCAGCAGCATAAGCTTGG - Intergenic