ID: 1168722277

View in Genome Browser
Species Human (GRCh38)
Location 19:58560735-58560757
Sequence CTCCCTAAAGTGGTCCTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168722277_1168722284 -1 Left 1168722277 19:58560735-58560757 CCGCTCAGGACCACTTTAGGGAG No data
Right 1168722284 19:58560757-58560779 GTAGGGTGCTGTTAGGGTAAGGG No data
1168722277_1168722287 21 Left 1168722277 19:58560735-58560757 CCGCTCAGGACCACTTTAGGGAG No data
Right 1168722287 19:58560779-58560801 GTAGCTGTACAGCTGAGCTGGGG No data
1168722277_1168722288 24 Left 1168722277 19:58560735-58560757 CCGCTCAGGACCACTTTAGGGAG No data
Right 1168722288 19:58560782-58560804 GCTGTACAGCTGAGCTGGGGTGG No data
1168722277_1168722286 20 Left 1168722277 19:58560735-58560757 CCGCTCAGGACCACTTTAGGGAG No data
Right 1168722286 19:58560778-58560800 GGTAGCTGTACAGCTGAGCTGGG No data
1168722277_1168722290 30 Left 1168722277 19:58560735-58560757 CCGCTCAGGACCACTTTAGGGAG No data
Right 1168722290 19:58560788-58560810 CAGCTGAGCTGGGGTGGGAGAGG No data
1168722277_1168722282 -7 Left 1168722277 19:58560735-58560757 CCGCTCAGGACCACTTTAGGGAG No data
Right 1168722282 19:58560751-58560773 TAGGGAGTAGGGTGCTGTTAGGG No data
1168722277_1168722289 25 Left 1168722277 19:58560735-58560757 CCGCTCAGGACCACTTTAGGGAG No data
Right 1168722289 19:58560783-58560805 CTGTACAGCTGAGCTGGGGTGGG No data
1168722277_1168722283 -2 Left 1168722277 19:58560735-58560757 CCGCTCAGGACCACTTTAGGGAG No data
Right 1168722283 19:58560756-58560778 AGTAGGGTGCTGTTAGGGTAAGG No data
1168722277_1168722281 -8 Left 1168722277 19:58560735-58560757 CCGCTCAGGACCACTTTAGGGAG No data
Right 1168722281 19:58560750-58560772 TTAGGGAGTAGGGTGCTGTTAGG No data
1168722277_1168722285 19 Left 1168722277 19:58560735-58560757 CCGCTCAGGACCACTTTAGGGAG No data
Right 1168722285 19:58560777-58560799 GGGTAGCTGTACAGCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168722277 Original CRISPR CTCCCTAAAGTGGTCCTGAG CGG (reversed) Intergenic
No off target data available for this crispr