ID: 1168722481

View in Genome Browser
Species Human (GRCh38)
Location 19:58561822-58561844
Sequence CAGGAACCACGTGGTTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168722470_1168722481 23 Left 1168722470 19:58561776-58561798 CCACCTCTCTCAGGGTGAAGAGG 0: 1
1: 0
2: 1
3: 20
4: 206
Right 1168722481 19:58561822-58561844 CAGGAACCACGTGGTTACAGAGG 0: 1
1: 0
2: 2
3: 5
4: 108
1168722474_1168722481 20 Left 1168722474 19:58561779-58561801 CCTCTCTCAGGGTGAAGAGGGGT 0: 1
1: 0
2: 1
3: 12
4: 151
Right 1168722481 19:58561822-58561844 CAGGAACCACGTGGTTACAGAGG 0: 1
1: 0
2: 2
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168722481 Original CRISPR CAGGAACCACGTGGTTACAG AGG Intergenic
905985062 1:42272890-42272912 TAGGAAGCACTTGGTTATAGTGG - Intronic
906266704 1:44436543-44436565 CAGAAACCACATGGTTCAAGTGG - Intronic
907045715 1:51298893-51298915 CAGAAACAAGGTGGTGACAGTGG - Intronic
907157655 1:52349158-52349180 CAGGAAGCACTTGTTAACAGGGG + Intronic
910173374 1:84401591-84401613 CATGATCCATGTGGCTACAGTGG - Intronic
916373924 1:164130658-164130680 AAGGACCCATGTGATTACAGTGG + Intergenic
918093996 1:181319460-181319482 CAAGACCCACGTATTTACAGTGG - Intergenic
923773970 1:236961741-236961763 CAGGCATCACATGGTGACAGAGG - Intergenic
1063865304 10:10358578-10358600 CAGGTCCCACTAGGTTACAGAGG - Intergenic
1066368929 10:34803277-34803299 CAGGAATCACGTGCTCACAAAGG + Intronic
1067764111 10:49072335-49072357 CAGGAACCAGCTGGTTGCTGGGG + Intronic
1077420131 11:2446161-2446183 TTGGAACCACCTGGTAACAGGGG - Intronic
1078707516 11:13759345-13759367 CAGGAGCCAGGATGTTACAGTGG + Intergenic
1081652545 11:44834091-44834113 CAGGAACCACGAGATTGCTGAGG + Intronic
1084497939 11:69516080-69516102 CAGGCATCACATGGTTAAAGTGG + Intergenic
1085400969 11:76235240-76235262 CAGGGACCACGAGTTTACACTGG - Intergenic
1095795228 12:46211518-46211540 CAAGAACCGCGTGGTTGCAGAGG - Intronic
1099564849 12:84230253-84230275 CAGGACCCAAGTGGGTCCAGAGG + Intergenic
1099584270 12:84496395-84496417 CAGAAAACAAGTTGTTACAGTGG - Intergenic
1099842626 12:87985309-87985331 CAGGAAGTACAAGGTTACAGGGG - Intronic
1102073551 12:110041947-110041969 TAAGAACCATTTGGTTACAGTGG - Exonic
1102707485 12:114894843-114894865 GAGGGACCACGTGGCAACAGTGG + Intergenic
1104534916 12:129609791-129609813 GAAGATCCACGTGGTAACAGGGG - Intronic
1104888302 12:132125000-132125022 CAGGAGCCACGTGGTTCTAATGG - Intronic
1105679318 13:22709323-22709345 CAGAAAAGAAGTGGTTACAGGGG - Intergenic
1115190530 14:30743248-30743270 AAGGATCCACATGGTTACACTGG + Intergenic
1116574153 14:46551758-46551780 CAGGAAGCCAGTGGTTAGAGAGG - Intergenic
1116903023 14:50379525-50379547 CAGAGACCAGGTGCTTACAGTGG + Intronic
1118017488 14:61674974-61674996 CTGCAACCAGGTGGTTAAAGTGG - Intergenic
1129850500 15:78790993-78791015 CAGGAACCAGGGGGTGGCAGGGG + Intronic
1132071267 15:98778494-98778516 CAGAAACCCAGTGGTCACAGTGG + Intronic
1133482819 16:6187634-6187656 CAGGATACAGGTGGTTCCAGTGG + Intronic
1135471605 16:22736385-22736407 CAGGGACCACATGGTGAGAGAGG + Intergenic
1135927240 16:26706125-26706147 CAGGAAGGACTTTGTTACAGAGG - Intergenic
1137323170 16:47407220-47407242 CTTGAACCAGGAGGTTACAGTGG + Intronic
1138216770 16:55211360-55211382 CAGGAAAGTCTTGGTTACAGAGG + Intergenic
1141694198 16:85612194-85612216 CAGGAAGCTCGGGGTTAAAGGGG - Intronic
1142728784 17:1836463-1836485 CAGGGGCAATGTGGTTACAGGGG - Intronic
1142742639 17:1940078-1940100 CAGGAACGAGGGGGTGACAGTGG - Intronic
1144176480 17:12712511-12712533 CTGGAGGCACGAGGTTACAGTGG + Intronic
1150726295 17:67654005-67654027 CTGGGACCACGAGGTTCCAGAGG + Intronic
1153387203 18:4511105-4511127 AAGGAACCTCGTGGTTTCCGTGG - Intergenic
1160072777 18:75643038-75643060 CAGAAGCCACGTGGGTAGAGGGG + Intergenic
1163129922 19:15265927-15265949 CAGGAAGCACATGCTGACAGGGG + Intronic
1163485240 19:17581484-17581506 CAGGCTCCACGTGCTTACTGAGG + Exonic
1164584320 19:29456852-29456874 CAGGAACCAAGGGGTGACAGTGG + Intergenic
1167174797 19:47858521-47858543 CAGGACCCACATGGGTTCAGGGG - Intergenic
1167666165 19:50823737-50823759 CAGGAACCACATGGTGACAGAGG + Exonic
1168156718 19:54477492-54477514 CAGGAACCAGCTGGGCACAGTGG - Intergenic
1168722481 19:58561822-58561844 CAGGAACCACGTGGTTACAGAGG + Intergenic
924987593 2:286603-286625 CAGAGACCACGAAGTTACAGAGG + Intronic
932696718 2:73963126-73963148 AAGGACCCACGTGATTACACTGG + Intergenic
936868949 2:117110022-117110044 CAAGAACCCCCTGGTAACAGTGG + Intergenic
937999319 2:127719782-127719804 CAGGGACCACCTGGTCCCAGAGG - Exonic
938093516 2:128447898-128447920 CAGGACCCACTGCGTTACAGTGG + Intergenic
938383178 2:130848008-130848030 AGGGAGCCACGTGGTTGCAGGGG + Intronic
941725635 2:168857350-168857372 AAGGAAAGACGTGGTTGCAGAGG + Intronic
946032499 2:216716352-216716374 CAGGAACCACTTGGTTCCAGAGG - Intergenic
946032500 2:216716355-216716377 CTGGAACCAAGTGGTTCCTGTGG + Intergenic
1171088073 20:22257303-22257325 CTTCAACCACGCGGTTACAGTGG + Intergenic
1172304908 20:33873815-33873837 CAGGAACCATGGGTTCACAGGGG - Intergenic
1172889968 20:38257194-38257216 CAGGAACCACGTCCTTATAGAGG + Intronic
1179568363 21:42263150-42263172 CCGGAACCACCTTGTTCCAGGGG + Intronic
1180096120 21:45555847-45555869 CAGGATCCACGTGGTCCCTGCGG + Intergenic
949514386 3:4794223-4794245 CAACAAACACTTGGTTACAGGGG - Intronic
950364125 3:12471204-12471226 CAGGAGCGATGTGGATACAGTGG - Intergenic
954556561 3:51521839-51521861 CAGGAATAACATGCTTACAGTGG - Intergenic
960082152 3:113553015-113553037 CAGGAACCAAGATGTGACAGGGG + Intronic
961393013 3:126567857-126567879 CATGACCCAGGTGGTCACAGGGG + Intergenic
961727814 3:128944440-128944462 CAGGACCCACTTGGATGCAGTGG - Intronic
962726370 3:138231839-138231861 CAGGAACCTGGTGGTTAGTGAGG - Intronic
963423450 3:145091999-145092021 CACAAAACACGTGGTTCCAGAGG - Intergenic
963691561 3:148509742-148509764 CAGGCACAACGTGGTAAAAGTGG - Intergenic
966562629 3:181340684-181340706 AAGGACCCTTGTGGTTACAGTGG - Intergenic
969562978 4:7961213-7961235 CAGGCCCCACGTGGTCAGAGAGG + Intergenic
969683700 4:8657252-8657274 CAGGGACCACGTGGCTAAGGAGG - Intergenic
972930385 4:44064615-44064637 CAGGCATCACATGGTGACAGAGG - Intergenic
977362262 4:96021170-96021192 TAGCAATGACGTGGTTACAGTGG - Intergenic
983456349 4:167969172-167969194 CAGGCCCCAGGTGGGTACAGAGG - Intergenic
985670896 5:1206101-1206123 CAGGCACCAAGTGGACACAGAGG + Intronic
987369467 5:17179997-17180019 CAGTAACCACGTGGGGCCAGTGG - Intronic
988548928 5:32182900-32182922 CAGAAATCACGTGGTGAGAGAGG - Intergenic
988959021 5:36350436-36350458 CAAGAACCACTGGGTTACACGGG + Intergenic
990613974 5:57488259-57488281 CAGGAACCACCAGATTATAGAGG + Intergenic
993205037 5:84868012-84868034 CAGGCATCACGTGGTGAGAGAGG - Intergenic
997842669 5:137256469-137256491 CAGGCATCACATGGTGACAGAGG + Intronic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
998674438 5:144391088-144391110 CAGGAAGCACCTGATTATAGTGG - Intronic
1000649997 5:163805525-163805547 CAGGAATTACATGGTAACAGCGG + Intergenic
1003429391 6:6025126-6025148 GAGGAACCAGGTAGATACAGAGG + Intergenic
1004194777 6:13493665-13493687 CAGGGACCAAGTGCTTGCAGGGG - Intergenic
1017766442 6:157610765-157610787 CAGGACCAACGTTGTCACAGGGG + Intronic
1018592918 6:165447192-165447214 CAGGAACCCTATGGCTACAGTGG - Intronic
1020067220 7:5197857-5197879 CAGGAAGCACCGGGGTACAGAGG - Intronic
1020151635 7:5686280-5686302 CAGAAACCACGTGGCAGCAGTGG - Intronic
1023172022 7:37399092-37399114 CAGGAGCCACCTGGATCCAGAGG + Intronic
1024911697 7:54454216-54454238 CTGGAACCATGGTGTTACAGTGG + Intergenic
1032479662 7:132236194-132236216 CATGAGCCACCTGTTTACAGAGG + Intronic
1034218374 7:149425025-149425047 AAGGAACCACTGGGTTAAAGTGG + Intergenic
1039626447 8:39059488-39059510 CAGGAACCACGTACTCACAGTGG - Intronic
1044659976 8:94585706-94585728 CAGGAACCAAGTGTTTACACTGG + Intergenic
1044967378 8:97586345-97586367 CAGGAAGCAGGTGGTTACCAAGG + Intergenic
1047337296 8:123948997-123949019 CAGGAGCCATGTGGACACAGAGG + Intronic
1048488663 8:134871515-134871537 CAGCAATCTCCTGGTTACAGTGG - Intergenic
1056579341 9:87879338-87879360 AAGGAAACTGGTGGTTACAGTGG - Intergenic
1057201626 9:93143542-93143564 CAGGAACCAGGGGGTCCCAGGGG - Intergenic
1058948092 9:109877419-109877441 CAGGAACCAGCAGGCTACAGGGG + Intronic
1059339278 9:113588335-113588357 ATGGAACCACGTGGAAACAGTGG - Intronic
1061564928 9:131432294-131432316 CAGGAACCTCCAGCTTACAGAGG - Intronic
1185922930 X:4114235-4114257 CAGGAGCCACTGGGTTAAAGTGG - Intergenic
1190783449 X:53621098-53621120 CTGGAACCACCTTATTACAGAGG + Intronic
1193555714 X:82951490-82951512 CAGGTACCAGGTGAATACAGAGG + Intergenic
1194274742 X:91865599-91865621 CTGGGACCAGGTGGGTACAGAGG + Intronic
1197770481 X:130086292-130086314 CTGGAATCAGGTGGTGACAGAGG - Intronic
1199724994 X:150571045-150571067 CAAGAACCATGTGTTTTCAGTGG - Intronic
1200591984 Y:5087000-5087022 CTGGGACCAGGTGGGTACAGAGG + Intronic