ID: 1168722482

View in Genome Browser
Species Human (GRCh38)
Location 19:58561823-58561845
Sequence AGGAACCACGTGGTTACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168722474_1168722482 21 Left 1168722474 19:58561779-58561801 CCTCTCTCAGGGTGAAGAGGGGT 0: 1
1: 0
2: 1
3: 12
4: 151
Right 1168722482 19:58561823-58561845 AGGAACCACGTGGTTACAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 116
1168722470_1168722482 24 Left 1168722470 19:58561776-58561798 CCACCTCTCTCAGGGTGAAGAGG 0: 1
1: 0
2: 1
3: 20
4: 206
Right 1168722482 19:58561823-58561845 AGGAACCACGTGGTTACAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168722482 Original CRISPR AGGAACCACGTGGTTACAGA GGG Intergenic
902663963 1:17924576-17924598 TGGGACCAGGTGGTCACAGAAGG + Intergenic
902837024 1:19053981-19054003 AGGAACCACCTGGTCCCACATGG - Intergenic
902998863 1:20249968-20249990 AGGACCCCTGTGGTTACATAAGG - Intergenic
904836818 1:33343038-33343060 ATGAGCCTCGTTGTTACAGATGG - Intronic
910501721 1:87900121-87900143 AGGAACCAGGCTGTTTCAGAAGG + Intergenic
911094734 1:94046008-94046030 AGTAACCGCCTGGTAACAGAAGG - Intronic
913013954 1:114713947-114713969 AGAAAACAAGTGGTTATAGATGG - Exonic
916373925 1:164130659-164130681 AGGACCCATGTGATTACAGTGGG + Intergenic
918033440 1:180840805-180840827 AGGAACGAGGTGCTTACACATGG - Intronic
921014497 1:211176028-211176050 AGGAACCATGAGGCTACACAAGG + Intergenic
1064321349 10:14308219-14308241 AGGAGCCACGAGTTTACAGTTGG - Intronic
1064358854 10:14645134-14645156 AGGAACCACTTAGTTACAACAGG + Intronic
1065410202 10:25417795-25417817 AGGAAACACCTGGTTAGGGATGG + Intronic
1070110216 10:73479415-73479437 AAGAACCACTTGGTGAAAGAAGG - Exonic
1070415293 10:76183631-76183653 AAGATCCATGTGGGTACAGAAGG + Intronic
1073104707 10:101025996-101026018 AGGAACTACCTGGCTACAAAGGG + Intronic
1076599243 10:131646442-131646464 AGGACCAACGTGGGTGCAGACGG - Intergenic
1077199397 11:1297909-1297931 AGGAAACACTGGGGTACAGAAGG + Intronic
1077420130 11:2446160-2446182 TGGAACCACCTGGTAACAGGGGG - Intronic
1079380015 11:19929879-19929901 AAGCACCACGTGGTAACACAAGG + Intronic
1080760214 11:35241566-35241588 AGGCACCAAGTGGTCAGAGACGG + Intergenic
1083276984 11:61602492-61602514 AGGCACAAAGGGGTTACAGAAGG - Intergenic
1088102427 11:106170072-106170094 AGGAACAATGAGGTTGCAGATGG - Intergenic
1092339270 12:7661673-7661695 AGGAACCACTTGGCTCCAGTTGG - Intronic
1097715231 12:62959295-62959317 AGGAACCACCTGGTTGCCCAGGG - Intergenic
1101320444 12:103668804-103668826 AGGGTCCACGTGGTCACAGGTGG + Intronic
1102073550 12:110041946-110041968 AAGAACCATTTGGTTACAGTGGG - Exonic
1102707486 12:114894844-114894866 AGGGACCACGTGGCAACAGTGGG + Intergenic
1104369378 12:128209778-128209800 AGGAACCACATGGCTTCAAAGGG + Intergenic
1106830171 13:33572654-33572676 TGGAACCCCTTGGATACAGAGGG - Intergenic
1110326565 13:74223077-74223099 AGGATCCAGATGTTTACAGAAGG - Intergenic
1113957875 13:114108800-114108822 AGGAGCCACGTTGTTACGGAAGG - Intronic
1115190531 14:30743249-30743271 AGGATCCACATGGTTACACTGGG + Intergenic
1116574152 14:46551757-46551779 AGGAAGCCAGTGGTTAGAGAGGG - Intergenic
1117551303 14:56839490-56839512 TGTAACCACCTGGTTACAAACGG + Intergenic
1121219887 14:92277426-92277448 AGGAACCAAGGGGCTAGAGAAGG - Intergenic
1122105268 14:99448387-99448409 AGGAAACCCGTGGCTGCAGATGG - Intronic
1123130388 14:105981079-105981101 AAGAAACACTTTGTTACAGAAGG - Intergenic
1123580628 15:21712300-21712322 AAGAAACACTTTGTTACAGAAGG - Intergenic
1123617276 15:22154923-22154945 AAGAAACACTTTGTTACAGAAGG - Intergenic
1124054753 15:26231974-26231996 AGGCACCACGTGGTGGCACAGGG + Intergenic
1125401146 15:39304610-39304632 AGCACCCACGTGGTAACAGCAGG + Intergenic
1127557188 15:60099215-60099237 AGGAACCTGGGGCTTACAGAAGG + Intergenic
1131822568 15:96287475-96287497 ATGAACCTCATGGTTTCAGATGG - Intergenic
1202989498 15_KI270727v1_random:446545-446567 AAGAAACACTTTGTTACAGAAGG - Intergenic
1135635938 16:24075658-24075680 AGGAACAACGAGGTTGCAAATGG + Intronic
1135689331 16:24523550-24523572 AGAAACCCCGGGCTTACAGAAGG - Intergenic
1135921965 16:26658686-26658708 AGGATGCACGTGGCTATAGAGGG - Intergenic
1138589836 16:57993726-57993748 AGGAACCACATGGTTTCTCAAGG + Intergenic
1140291647 16:73664723-73664745 AGCTACCACCTGGTTACAGCAGG + Intergenic
1144891751 17:18498253-18498275 AGGAGCCCCGTGGATACTGAAGG - Intergenic
1145140471 17:20446064-20446086 AGGAGCCCCGTGGATACTGAAGG + Intergenic
1149217117 17:54370316-54370338 CGGAACCACATGGACACAGAGGG - Intergenic
1151324340 17:73369596-73369618 AGGAACCCCGTGGCTGCAGAAGG + Intronic
1152962035 18:85919-85941 AGGGTCCACGTGGTTACTGCAGG - Intergenic
1154251789 18:12750944-12750966 AGGACCCAAGTGGAGACAGAGGG - Intergenic
1155438147 18:25834182-25834204 AGGCACCACGAGGCTATAGAAGG - Intergenic
1156577218 18:38331228-38331250 AGTAACCATTTGGTCACAGATGG - Intergenic
1164584321 19:29456853-29456875 AGGAACCAAGGGGTGACAGTGGG + Intergenic
1168722482 19:58561823-58561845 AGGAACCACGTGGTTACAGAGGG + Intergenic
929044243 2:37775024-37775046 AGGAGCAAAGTGGGTACAGATGG + Intergenic
931034618 2:58225590-58225612 AGGATCCACGTGGTATCTGATGG - Intronic
936986481 2:118315754-118315776 CTGAAACACCTGGTTACAGAAGG - Intergenic
940836962 2:158533108-158533130 AGGAACCAAGGCTTTACAGATGG - Intronic
941362995 2:164576008-164576030 ATGAAACACTTGGTTATAGAGGG - Intronic
941725636 2:168857351-168857373 AGGAAAGACGTGGTTGCAGAGGG + Intronic
947752926 2:232542068-232542090 AGGACCCCCGTGTCTACAGAGGG - Intronic
1171334792 20:24373724-24373746 AGGAACAATGGGGATACAGATGG + Intergenic
1172889969 20:38257195-38257217 AGGAACCACGTCCTTATAGAGGG + Intronic
1174697855 20:52578602-52578624 GGGAACCCCGTGTATACAGAGGG - Intergenic
1184949840 22:47833436-47833458 AGGAATCAGGTGGCTAGAGAGGG + Intergenic
1203296358 22_KI270736v1_random:46411-46433 AGGAGCAAAGTGGGTACAGATGG + Intergenic
951536503 3:23745121-23745143 AGGAATAATGTGGTTAAAGATGG - Intergenic
954185180 3:48911587-48911609 AGGCACCAAGTTGTTATAGATGG - Intergenic
955529421 3:59857863-59857885 AGAAACCAGGTGGTGAAAGAAGG + Intronic
961810786 3:129520394-129520416 AGGAATTCCGTGGTTACACAAGG - Intronic
962456096 3:135567070-135567092 AGAAAACATCTGGTTACAGAAGG - Intergenic
963500318 3:146117532-146117554 AGTAACCAGGAGGTTAAAGAGGG - Intronic
966562628 3:181340683-181340705 AGGACCCTTGTGGTTACAGTGGG - Intergenic
967080178 3:186042635-186042657 AGGAACAACGTGGGGACAGGTGG - Intergenic
970608487 4:17704457-17704479 AGGAACCACGTGAAGACACAAGG - Intronic
971793344 4:31196949-31196971 AGGAGCCATGTGATTACAGTTGG - Intergenic
972930384 4:44064614-44064636 AGGCATCACATGGTGACAGAGGG - Intergenic
974928445 4:68331268-68331290 AGGAACCCTGTGGATACCGAGGG + Intronic
978954642 4:114598983-114599005 AGGGACCACGCCGTTCCAGAGGG + Intronic
979631063 4:122903720-122903742 AGGAACCACGAGCACACAGAAGG - Intronic
980240305 4:130164874-130164896 AGAAACCACATGGTTATGGAAGG + Intergenic
980994560 4:139767854-139767876 AGGAACCAAGTGGTCAAAGGTGG - Intronic
983330484 4:166321327-166321349 AGGATCCACGTGATTACATTAGG - Intergenic
985670897 5:1206102-1206124 AGGCACCAAGTGGACACAGAGGG + Intronic
986079529 5:4375716-4375738 AGGAAACAGCTGGGTACAGACGG - Intergenic
996365166 5:122693373-122693395 AGGAACATGGTGATTACAGATGG + Intergenic
997759064 5:136427478-136427500 AAGAGCCAGGTGGTTAAAGAAGG - Intergenic
997842670 5:137256470-137256492 AGGCATCACATGGTGACAGAGGG + Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
999799353 5:155019156-155019178 TGGAACAACCTGCTTACAGAGGG - Intergenic
1001263310 5:170252132-170252154 AGGAATCACATGGTGTCAGAAGG - Intronic
1007476389 6:42122516-42122538 AGGAACCAGGTGGGTAGAGAAGG + Intronic
1011135562 6:84096249-84096271 AGGGACCATGTGGTTATGGATGG + Intergenic
1012569987 6:100712428-100712450 ATGAACCACCTGGTTAAAAATGG + Intronic
1014703672 6:124720765-124720787 AGGAACCAGGTGGTTCCATTTGG + Intronic
1017984901 6:159435409-159435431 AGGAACCACGTGGGTGCCGTAGG + Intergenic
1022404356 7:30073352-30073374 AGGAAACAGATGGTTAGAGAGGG + Intronic
1023237501 7:38105858-38105880 ATGACCCAAGTGGCTACAGAAGG - Intergenic
1026058636 7:67006898-67006920 AGGTACCACATGGTGAGAGAGGG + Intronic
1026248390 7:68644819-68644841 TGGAACCACGTGGACACTGAGGG + Intergenic
1026719458 7:72818120-72818142 AGGTACCACATGGTGAGAGAGGG - Intronic
1031444692 7:121836932-121836954 AGGAAAAATGTGGTTACACAAGG - Intergenic
1034218375 7:149425026-149425048 AGGAACCACTGGGTTAAAGTGGG + Intergenic
1034353481 7:150432624-150432646 TGAATCCACGTGCTTACAGAGGG + Intergenic
1040781627 8:51116412-51116434 AGGAACAACAGGGATACAGATGG + Intergenic
1041619895 8:59954676-59954698 AGGAAACTTGTGGTTACATAGGG - Intergenic
1046827470 8:118707001-118707023 AGGAACCTGGTTGTTACAGCTGG + Intergenic
1052803586 9:32992410-32992432 AGAAACCTCCTGGTTAGAGATGG + Intronic
1056579340 9:87879337-87879359 AGGAAACTGGTGGTTACAGTGGG - Intergenic
1059136926 9:111816025-111816047 AGGAACAATGGGGATACAGATGG + Intergenic
1059141025 9:111853336-111853358 AGGTACCTCGTGGTTCAAGATGG + Intergenic
1061785923 9:133028430-133028452 AAGAACCACGTGTTTCCACAGGG - Intergenic
1062704040 9:137924955-137924977 AGGAACCCCCTGGTCACAGGCGG - Intronic
1062736107 9:138138198-138138220 AGGGTCCACGTGGTTACTGCAGG + Intergenic
1188169654 X:26909234-26909256 AGGACCCATGTAGTTAGAGATGG - Intergenic
1197110244 X:122764129-122764151 ATGAATCACTTGGTTATAGATGG - Intergenic