ID: 1168724297

View in Genome Browser
Species Human (GRCh38)
Location 19:58572373-58572395
Sequence CTGATTTAGCTGGGGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 1, 2: 3, 3: 22, 4: 199}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168724287_1168724297 14 Left 1168724287 19:58572336-58572358 CCCAACATCACACTACGCAATGC 0: 1
1: 0
2: 0
3: 0
4: 51
Right 1168724297 19:58572373-58572395 CTGATTTAGCTGGGGTTGGAAGG 0: 1
1: 1
2: 3
3: 22
4: 199
1168724289_1168724297 -8 Left 1168724289 19:58572358-58572380 CCCCATCTCAGCTTCCTGATTTA 0: 1
1: 0
2: 3
3: 48
4: 522
Right 1168724297 19:58572373-58572395 CTGATTTAGCTGGGGTTGGAAGG 0: 1
1: 1
2: 3
3: 22
4: 199
1168724288_1168724297 13 Left 1168724288 19:58572337-58572359 CCAACATCACACTACGCAATGCC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1168724297 19:58572373-58572395 CTGATTTAGCTGGGGTTGGAAGG 0: 1
1: 1
2: 3
3: 22
4: 199
1168724285_1168724297 27 Left 1168724285 19:58572323-58572345 CCCATCTTCTAAGCCCAACATCA 0: 1
1: 0
2: 4
3: 144
4: 5252
Right 1168724297 19:58572373-58572395 CTGATTTAGCTGGGGTTGGAAGG 0: 1
1: 1
2: 3
3: 22
4: 199
1168724290_1168724297 -9 Left 1168724290 19:58572359-58572381 CCCATCTCAGCTTCCTGATTTAG 0: 1
1: 1
2: 5
3: 96
4: 1039
Right 1168724297 19:58572373-58572395 CTGATTTAGCTGGGGTTGGAAGG 0: 1
1: 1
2: 3
3: 22
4: 199
1168724286_1168724297 26 Left 1168724286 19:58572324-58572346 CCATCTTCTAAGCCCAACATCAC 0: 1
1: 0
2: 4
3: 150
4: 5306
Right 1168724297 19:58572373-58572395 CTGATTTAGCTGGGGTTGGAAGG 0: 1
1: 1
2: 3
3: 22
4: 199
1168724284_1168724297 28 Left 1168724284 19:58572322-58572344 CCCCATCTTCTAAGCCCAACATC 0: 1
1: 1
2: 112
3: 4825
4: 7856
Right 1168724297 19:58572373-58572395 CTGATTTAGCTGGGGTTGGAAGG 0: 1
1: 1
2: 3
3: 22
4: 199
1168724291_1168724297 -10 Left 1168724291 19:58572360-58572382 CCATCTCAGCTTCCTGATTTAGC 0: 1
1: 1
2: 3
3: 51
4: 356
Right 1168724297 19:58572373-58572395 CTGATTTAGCTGGGGTTGGAAGG 0: 1
1: 1
2: 3
3: 22
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168724297 Original CRISPR CTGATTTAGCTGGGGTTGGA AGG Intronic
900179783 1:1306034-1306056 GTGATTTAACTGGGGTTCGAGGG - Intronic
902284774 1:15400410-15400432 CTGTCTTGGCTGGGGCTGGATGG + Intergenic
903136891 1:21315289-21315311 CGGATTCAGCTGCAGTTGGATGG - Intronic
903309745 1:22445336-22445358 CTGATTTAGATGGGGCAGGATGG - Intergenic
903732272 1:25505351-25505373 CTGATTTAACTGGGCTGGGGAGG + Intergenic
904315563 1:29658058-29658080 CTGGCTCAGCTGGGGCTGGATGG - Intergenic
904972872 1:34432795-34432817 CAGGGTCAGCTGGGGTTGGATGG - Intergenic
906636821 1:47415851-47415873 CTGTTCCAGCTGGGGATGGAAGG + Intergenic
906962326 1:50426135-50426157 CTGATTTGGATTGGGTTGGTCGG + Intergenic
908692993 1:66803691-66803713 CTCATTTAGTTTGGGATGGAAGG + Intergenic
911281489 1:95934999-95935021 CTTACTTTGCTGGGGTTTGAAGG + Intergenic
914520280 1:148409003-148409025 CTGATTCATTTGGGGCTGGATGG + Intergenic
915082724 1:153363063-153363085 CTGATTGAACAGGGGGTGGAGGG - Intergenic
916738512 1:167629140-167629162 CTGGTTGAGCTGGGGTTGGGCGG + Intergenic
918343888 1:183589997-183590019 CTGATTTAACTGGTCTGGGAGGG - Intronic
921687393 1:218105387-218105409 CTGATTTTGCAGGGGATGGGTGG + Intergenic
923048820 1:230375849-230375871 CTGCTCTAGCTGGTGTGGGAGGG - Intronic
923572885 1:235132111-235132133 CTGATACACCTGGGATTGGATGG - Intronic
924268171 1:242303992-242304014 CTCATTTAGCTGGTGTCGGTGGG - Intronic
924465224 1:244293498-244293520 CTGATTTAATTGGGGTGGGGCGG - Intergenic
1063168947 10:3488674-3488696 CTGTTTTAACTGGGGTGAGATGG + Intergenic
1064937080 10:20689798-20689820 TTTATTTATCTGGGTTTGGAAGG + Intergenic
1065731212 10:28711447-28711469 CTCTTTTAACGGGGGTTGGAGGG - Intergenic
1066716734 10:38294748-38294770 CTCATTTAGCTGGTGTCGGTGGG + Intergenic
1070423129 10:76257827-76257849 CTGACTTGGTTGGGGCTGGATGG + Intronic
1070577694 10:77691998-77692020 ATGTTTTGTCTGGGGTTGGATGG + Intergenic
1072536243 10:96365763-96365785 CTGATTCAGCTGGGGCTAGCTGG - Exonic
1073132688 10:101200426-101200448 CAGATTTCACTGGGGCTGGAAGG + Intergenic
1074213568 10:111361747-111361769 CTGATTTAGCTGGTCTCAGAAGG - Intergenic
1074353228 10:112758444-112758466 CTGATTTAGCAGGTCTAGGATGG - Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1078061597 11:8049346-8049368 CTGATTTAGTTGGTCTAGGATGG - Intronic
1080963979 11:37193506-37193528 TTGATGTACCTGGGTTTGGAAGG + Intergenic
1083619155 11:64040470-64040492 CTGAGAGAGCTGGGGATGGATGG - Intronic
1083713057 11:64560443-64560465 CTGGTGGAGCTGGGGGTGGATGG - Intronic
1088238796 11:107752712-107752734 CTGCTTTAGGTGGGGATGGATGG - Intergenic
1090046771 11:123342639-123342661 GTCATTTAGCTGAGTTTGGAAGG + Intergenic
1091187590 11:133660164-133660186 CTTATTTAGCAGGGATTGTAGGG + Intergenic
1091826329 12:3515554-3515576 CTGATTTAGCAGGTCTGGGATGG - Intronic
1094108886 12:26839905-26839927 CTGATTTAGCTTGTCTTGGTGGG + Intergenic
1096802099 12:54117397-54117419 CTGATTTAGCAGAGGGTGAAGGG + Intergenic
1097283361 12:57859584-57859606 CTGATTGTGCTGGGGATGGCTGG + Intergenic
1100004483 12:89877741-89877763 AGGAAATAGCTGGGGTTGGAAGG - Intergenic
1100721880 12:97368035-97368057 CTGGTTTGGCTGGGGCTGGATGG + Intergenic
1101445908 12:104736684-104736706 CTGATTTACCCGGAGTTGGCAGG + Intronic
1102280459 12:111614785-111614807 CTAGTTCAACTGGGGTTGGATGG + Intergenic
1102995680 12:117348247-117348269 CTGATGTCGCAGAGGTTGGAAGG + Intronic
1103266707 12:119636576-119636598 CTGAGTTAGCTGGGATTACAGGG + Intronic
1105784897 13:23738853-23738875 CTGATTCAGCAGGGCTCGGATGG - Intronic
1106603206 13:31204704-31204726 CTGATGGAGCAGGAGTTGGAGGG + Intronic
1106737968 13:32607679-32607701 CTCCTTTAGCTGGGGTGGGGTGG + Intronic
1110038997 13:70728370-70728392 CTGATTTAGCTGGGGTTGGCTGG - Intergenic
1110080915 13:71309987-71310009 CTGCTTTAGCTGAGGGTGAAGGG - Intergenic
1111039115 13:82721108-82721130 CTGGTTCAGCTGGGGCCGGATGG - Intergenic
1112426252 13:99304060-99304082 GTGGTTTGCCTGGGGTTGGATGG - Intronic
1113262105 13:108575973-108575995 CAAATCTAGCTGGGGCTGGAAGG + Intergenic
1118512928 14:66495998-66496020 CTGATTTATCTGTGGTGGAAGGG - Intergenic
1119440414 14:74624485-74624507 CTGTCTGAGCTGGGGCTGGAAGG + Intergenic
1120462342 14:84813248-84813270 CTAATTTAGCTTGGGTTGGAAGG - Intergenic
1120502989 14:85320276-85320298 CTGACTTAGCTGGGGAAGGTAGG - Intergenic
1121178441 14:91908724-91908746 CTGATTTAACTGGGTTGGGATGG - Intronic
1121632940 14:95434052-95434074 CTGATATGGCTGGAGTTGGGTGG + Intronic
1121937228 14:98031057-98031079 CTGATTTATTTGGGTTTGAAAGG + Intergenic
1124691056 15:31823276-31823298 CTTATTAAGCTGGGCTTCGAGGG + Intronic
1124835123 15:33189183-33189205 CATATTTACTTGGGGTTGGATGG + Intronic
1126676276 15:51161587-51161609 CTGATCTGGCTGGGGTTGTCTGG - Intergenic
1130971969 15:88740691-88740713 CTGAGTAGGCTGGGGTTGGAGGG - Intergenic
1131313047 15:91308065-91308087 CTGATTTAGCTGGCATTGTTGGG + Intergenic
1132400003 15:101499281-101499303 CTGTTTTAGATGGGGGTGCAGGG - Intronic
1132826557 16:1908177-1908199 CTGGTCTGGCTGGGGTAGGAGGG + Intergenic
1135270380 16:21064386-21064408 CAGATTGAGCTGGGCTTGGCTGG - Intronic
1135486915 16:22873792-22873814 CTGGTCTAGCTGGGGTTGGCTGG + Intronic
1136295744 16:29301215-29301237 CTGAGTTAGCTGGAGTTAGCTGG + Intergenic
1137616512 16:49851268-49851290 CTGATTTAGGTGGTGGTGGTGGG - Intronic
1137757294 16:50912898-50912920 ATGGATGAGCTGGGGTTGGAGGG - Intergenic
1139216338 16:65127368-65127390 ATGATTTAGCTGGGGTTGCCTGG + Intergenic
1140180631 16:72714408-72714430 TTGATTCAGCTGGGGTGGTAGGG + Intergenic
1140340076 16:74149373-74149395 TTGATTTTGCTGGGATTGGAGGG + Intergenic
1140474106 16:75230015-75230037 CTGCTTCAGCTGGGGCAGGAGGG + Exonic
1142101662 16:88275402-88275424 CTGAGTTAGCTGGAGTTAGCTGG + Intergenic
1143516696 17:7422801-7422823 CTGATTTATTTGGGGAGGGATGG + Intergenic
1145362746 17:22225746-22225768 ATGAATTAGCTGTGGTGGGAGGG + Intergenic
1145822647 17:27851543-27851565 CTGATTTAATTGGTGTTGGGTGG + Intronic
1148509202 17:48154432-48154454 GTGGCTTAGCTGGGGTGGGAAGG - Intronic
1151404661 17:73878554-73878576 CTGTTGTGGCTGGGGTTGGGAGG + Intergenic
1152292089 17:79445783-79445805 CTGATTCAGCCGGGGTTTGCAGG + Intronic
1155514935 18:26615182-26615204 CTGAGTTGGATGGGGTGGGAAGG - Intronic
1155786294 18:29905353-29905375 ATGATGCAGCTGGAGTTGGAAGG - Intergenic
1156218534 18:35027536-35027558 CTCATGTAGCTATGGTTGGAAGG - Intronic
1158107876 18:53905683-53905705 CTGCTTTAGGATGGGTTGGAGGG + Intergenic
1161311323 19:3595706-3595728 CTGCGTGAGCTGGGGCTGGAGGG + Intronic
1161840594 19:6678009-6678031 ATGATGTAGCTGAGGCTGGAGGG + Exonic
1165163626 19:33833881-33833903 CTGATTTATCTGGGTTTTGGAGG - Intergenic
1166438239 19:42787812-42787834 CCTAATTAGCTGGGGTTTGATGG - Intronic
1166467129 19:43042460-43042482 CCGAATTAGCTGGGGTTTGATGG - Intronic
1166473264 19:43098546-43098568 CCTAATTAGCTGGGGTTTGATGG - Intronic
1166487213 19:43223658-43223680 CCTAATTAGCTGGGGTTTGATGG - Intronic
1166494056 19:43285544-43285566 CCTAATTAGCTGGGGTTTGATGG - Intergenic
1166495441 19:43299794-43299816 CCGAATCAGCTGGGGTTTGATGG - Intergenic
1168724297 19:58572373-58572395 CTGATTTAGCTGGGGTTGGAAGG + Intronic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
926100230 2:10111210-10111232 CTGATTTAGGTGGGGTGCGGTGG + Intergenic
928020886 2:27703843-27703865 TGCATTTAGCTGGGGTTGGTTGG + Intergenic
929454449 2:42055980-42056002 GGGGTTTAGCTGGGGTTGGCAGG + Intronic
929938496 2:46312602-46312624 GTGATTTGGCTGCAGTTGGAAGG + Intronic
930002109 2:46868590-46868612 CTGTTTTAGGTCGGGTTGGGTGG - Intergenic
930935462 2:56945062-56945084 TTTATTAAGCTGGGCTTGGAAGG - Intergenic
930964052 2:57298021-57298043 CTGTTGTTGCTGGGGCTGGAGGG - Intergenic
932655416 2:73607417-73607439 CTGTTCTAGCAGGGGTTGGGTGG - Intronic
934089347 2:88537835-88537857 CAGGTTGAGATGGGGTTGGAGGG - Intergenic
934133898 2:88976311-88976333 CTGACTGAGCTGGGGGTAGAAGG + Intergenic
934138958 2:89026687-89026709 CTGATTGAGCTGGGGGTAGAAGG + Intergenic
934230285 2:90173874-90173896 CTGATTGAGCTGGGGGTAGAAGG - Intergenic
935452582 2:103227183-103227205 CAGGTGTAGCTGGGGTAGGATGG + Intergenic
936464291 2:112733422-112733444 CTTCTTTAGATGGGGTGGGAGGG + Intronic
939638918 2:144615448-144615470 ATGCTTTAGATGGGGTGGGAAGG + Intergenic
940169617 2:150813748-150813770 CTGATGTGGCTGATGTTGGAAGG - Intergenic
941644659 2:168027077-168027099 CTGAGTTTGTTGAGGTTGGAGGG + Intronic
942993596 2:182233288-182233310 CAGACTGAGTTGGGGTTGGATGG + Intronic
944952261 2:204765260-204765282 CTGATTCAGCAGGTCTTGGATGG - Intronic
946056327 2:216905513-216905535 CTGATTTAGGTGGTGTGGGGTGG - Intergenic
947186820 2:227463036-227463058 GTGATGGAGCTGGGATTGGAAGG - Intergenic
948363802 2:237441562-237441584 CTCATTTAGATGGGGTTTAAGGG + Intergenic
1170045725 20:12083334-12083356 CTGATTTAGTAGGGCTGGGATGG + Intergenic
1170157915 20:13285407-13285429 CTGGCTTGGCTGGGGCTGGATGG + Intronic
1170970902 20:21115753-21115775 CTGATACAGTTGGGGTGGGATGG - Intergenic
1171301238 20:24062523-24062545 CTGGATTATCTGGGGCTGGAGGG - Intergenic
1172212845 20:33213296-33213318 CTGATTTAGTGGGGGCTGGGGGG - Intergenic
1172376465 20:34445278-34445300 CTGATTTAGCTGGGAACGGCGGG + Exonic
1174044614 20:47724582-47724604 CTCAATTAGCTGGGTATGGAGGG + Intronic
1174179197 20:48664432-48664454 CTATTTTAGCTGGGGTTGTGGGG + Intronic
1174699452 20:52592994-52593016 CTCATTAAGTTGGGGTTTGAAGG + Intergenic
1178585422 21:33867094-33867116 CTGAGAGACCTGGGGTTGGAAGG - Intronic
1179449829 21:41460838-41460860 CTGATTTGGGTGGTGGTGGAAGG - Intergenic
1179557789 21:42191529-42191551 CTCATGTAGCTGGAGTTGAAAGG - Intergenic
1181828663 22:25540841-25540863 CTGATCTAGGTGGGCTTGGCTGG + Intergenic
1181853039 22:25763548-25763570 CTGTTTGAGCTGGGTTTTGAAGG - Intronic
1183023255 22:35044188-35044210 ATGAATTTGCTGGGGTTGGAGGG - Intergenic
1183147420 22:36006816-36006838 CTTATCTGGCTGGGGTGGGATGG - Intronic
1183354165 22:37349567-37349589 CTGATGTCCCTGGGGTAGGAGGG - Intergenic
1185007527 22:48290845-48290867 CTGATTCAGCAGGTGTTGGGTGG - Intergenic
949903341 3:8838073-8838095 CTGGTTTGGCTGGGACTGGATGG - Intronic
950222096 3:11204378-11204400 CTGTTTGAGCTGAGATTGGAAGG + Intronic
951162469 3:19441357-19441379 CTGGTTTTCCTGGGGTTGGAAGG - Intronic
952276504 3:31882449-31882471 CTGATTCAGCAGGGCTTGGGTGG - Intronic
954418338 3:50405224-50405246 CTGGTTGGGCTGGGGGTGGAGGG + Intronic
954602893 3:51884815-51884837 GTAATTTGGCTGGAGTTGGAAGG + Intergenic
955365146 3:58304458-58304480 CTGGTTTTGCTTGGGTTGGGGGG - Intergenic
957341921 3:78910918-78910940 CTGATTTAGCAGATGTGGGATGG - Intronic
961353724 3:126320867-126320889 CTGATTTAGCAGGGGAAGGGTGG + Intergenic
961501012 3:127336142-127336164 CTGATCTAGATGTGGTCGGATGG + Intergenic
962364535 3:134769332-134769354 CAGAGTTACCTGGGGTTGGGGGG - Intronic
962652339 3:137509434-137509456 CTGAATGAGCTGGGGTGGCAGGG - Intergenic
964205880 3:154174499-154174521 CAAATTCAGCAGGGGTTGGAGGG + Intronic
965720958 3:171661732-171661754 TTGTTTTCGCTTGGGTTGGAGGG - Intronic
967101733 3:186221444-186221466 CTGATTTGGCGGAGGGTGGAGGG + Intronic
967516346 3:190373224-190373246 CTGTTTCAGCAGGGGTTGCAGGG + Intronic
967748824 3:193090257-193090279 CTGATTTAGTTGAGTTGGGATGG - Intergenic
970362726 4:15326054-15326076 CTGATTTAGCGGGTCTGGGATGG - Intergenic
970584539 4:17502482-17502504 CTGATATAGGAGGGGTTGGTAGG + Intronic
971479118 4:27098767-27098789 CTCACTTAACTGGGGTGGGATGG - Intergenic
974063028 4:57052596-57052618 CTGCTTTACCTGGGGTGGGGTGG - Intronic
975272102 4:72448072-72448094 CTGAGTTAGCTTCGTTTGGAAGG - Intronic
975839296 4:78456668-78456690 CTGATTCAGATGGGGTTGAAGGG + Intronic
978498244 4:109383039-109383061 CTGATTTAGTAGGTTTTGGATGG + Intergenic
978625506 4:110680421-110680443 CAGATTTTGCAGGGGTGGGATGG + Intergenic
978860000 4:113437530-113437552 CTGATTTTGCTTGGGTTGGATGG + Intergenic
980115572 4:128675859-128675881 TTGTTTTAACTGGAGTTGGAGGG - Intergenic
985725692 5:1514803-1514825 CTGTTTTGGCTGGAGGTGGAAGG - Intronic
987552635 5:19403635-19403657 CTGATGTTCCTGGGGGTGGAAGG + Intergenic
991496502 5:67231829-67231851 CTGCTTTTGCTGTGGCTGGATGG + Intergenic
992013314 5:72552367-72552389 GGGATTTGGCTGGGCTTGGAAGG - Intergenic
994147665 5:96412894-96412916 GTCATTTAGTTGGGGTGGGAGGG - Intronic
994656465 5:102600067-102600089 CTTATTTAGCTGCGGTCAGACGG - Intergenic
994905316 5:105834010-105834032 CTGATTTAATTGGTGTAGGAGGG - Intergenic
996393339 5:122987326-122987348 CTGATCTAGCTGGTCTTGGGTGG - Intronic
998638709 5:143985710-143985732 CTGCTTTAGCTGGGGTGGCCTGG - Intergenic
1000996391 5:167963170-167963192 CTGCTTCAGCTGGGTTTTGAGGG + Intronic
1002595222 5:180317809-180317831 CTGATTTGAGTGGGATTGGATGG + Intronic
1003814250 6:9819588-9819610 CTCAATTACCTGGGGCTGGAAGG - Intronic
1004313401 6:14565477-14565499 CTGTTTTGGCTGGGGGTGGTAGG - Intergenic
1005602619 6:27443228-27443250 CTGACTTAACTGGGCCTGGAGGG + Intergenic
1008653150 6:53584084-53584106 GTGGTTCAGCTGGAGTTGGATGG - Intronic
1009802435 6:68556421-68556443 CTGATTTACCTGGGCTTTAAAGG - Intergenic
1014166682 6:118232905-118232927 CTGATTTAACTGGTCTTGGGTGG - Intronic
1014730663 6:125027842-125027864 CTGTTTTAACTGGGGTGAGACGG + Intronic
1016605245 6:145914157-145914179 CTGAGTTGGCTGGGGTTGGATGG + Intronic
1017854868 6:158341600-158341622 CTGTTTTAACTGGGGTGAGATGG + Intronic
1019894227 7:3971239-3971261 CTGATTTAGGAGGGGTGGGTGGG + Intronic
1020709462 7:11588597-11588619 GTGATTTAGCAGTGGTTGGGGGG + Intronic
1021949968 7:25765054-25765076 CTGTTTTATCTGAGGTTGAAAGG + Intergenic
1022440210 7:30426916-30426938 CTGATTTAGATGAGGTTGCAGGG - Intronic
1023476018 7:40578633-40578655 CTCATTTTGCTGGGTTTGGGAGG - Intronic
1025145133 7:56495394-56495416 CTGCTCTAGCTGGGAGTGGAAGG + Intergenic
1028315101 7:89391813-89391835 CTGAATTAGTTGGTGTTAGATGG - Intergenic
1030105239 7:105981776-105981798 CAGATTTGGGTGGGGGTGGAGGG - Intronic
1031914512 7:127550303-127550325 CTAATTTTGGTGGGGTTGGAGGG - Intergenic
1033105211 7:138514616-138514638 CTCATTTTAGTGGGGTTGGAAGG - Intronic
1033209595 7:139451102-139451124 CTGCTTTAGATGGTATTGGATGG - Intergenic
1035274137 7:157737382-157737404 CTGAGTGCGCTGGGCTTGGAGGG + Intronic
1035357511 7:158285441-158285463 CTGCTTGTGCTGGGGTTGGGCGG - Intronic
1037928111 8:22860813-22860835 CTCAGTAAGCTGGGCTTGGATGG - Intronic
1038572225 8:28672611-28672633 CTGATTTAGTCGGTTTTGGATGG - Intronic
1038934680 8:32235635-32235657 CTGGTTTGCCTGGGGTTGAAGGG + Intronic
1039819792 8:41125479-41125501 CTCACTTAGGTAGGGTTGGAGGG - Intergenic
1044690896 8:94877460-94877482 CTAATTTACCTGGGGCTGGAAGG + Intronic
1047436081 8:124836343-124836365 CTCCTTTTGCTGGGATTGGATGG + Intergenic
1047860317 8:128958746-128958768 CTGAAATAGATGGGATTGGAGGG + Intergenic
1051618549 9:19029562-19029584 CAGATTTAATTGGGGTGGGAGGG + Intronic
1054153519 9:61624280-61624302 CTGATTTAGCAGAGGGTGAAGGG - Intergenic
1054993085 9:71353000-71353022 CTGATTTGGTTGGTGTGGGATGG - Intronic
1055111721 9:72566500-72566522 CTGTTTCAGGTGGGGTTGGAGGG + Intronic
1055693183 9:78856230-78856252 CTGTTTATGCTGGGGTGGGAGGG - Intergenic
1057631864 9:96725789-96725811 CTGATTTAGCTGGAATAGGATGG - Intergenic
1059954227 9:119499160-119499182 ATGTTTTGGCAGGGGTTGGAGGG + Intronic
1060350615 9:122855707-122855729 ATGATTTTGCTGGGGTTGCAGGG - Intronic
1061860004 9:133463181-133463203 TTGATGTAGCTGGGGTCAGAGGG + Intronic
1186537161 X:10361918-10361940 CTGATTTAGCAGGTTTTGGGTGG + Intergenic
1188625762 X:32283213-32283235 CTGACTCAGCTGGGCTTGGCCGG - Intronic
1189051903 X:37654262-37654284 CTGATTTACCTGGTATTAGAAGG - Intronic
1190150738 X:47945204-47945226 TAGATTTAGCTGTGGTTGGCTGG - Intronic
1190235904 X:48615604-48615626 CTCAGTTAGCTGTGGTAGGAGGG - Intergenic
1190720531 X:53143836-53143858 CTGGCTTTGCTGGGGATGGATGG - Intergenic
1192496886 X:71622143-71622165 CTGCCTTAACTGGGGGTGGAGGG + Intergenic
1193293853 X:79810076-79810098 CTGTTCTGCCTGGGGTTGGATGG + Intergenic
1195927116 X:110037439-110037461 CTGATGTGGCTGGGTTTTGATGG - Intronic