ID: 1168724866

View in Genome Browser
Species Human (GRCh38)
Location 19:58575572-58575594
Sequence CGCACTGCGACCCGAAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168724860_1168724866 4 Left 1168724860 19:58575545-58575567 CCGCCAGCCCAGCTAAAGCAGAC 0: 1
1: 0
2: 1
3: 24
4: 196
Right 1168724866 19:58575572-58575594 CGCACTGCGACCCGAAGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1168724864_1168724866 -4 Left 1168724864 19:58575553-58575575 CCAGCTAAAGCAGACGGCTCGCA 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1168724866 19:58575572-58575594 CGCACTGCGACCCGAAGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1168724862_1168724866 1 Left 1168724862 19:58575548-58575570 CCAGCCCAGCTAAAGCAGACGGC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1168724866 19:58575572-58575594 CGCACTGCGACCCGAAGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1168724863_1168724866 -3 Left 1168724863 19:58575552-58575574 CCCAGCTAAAGCAGACGGCTCGC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1168724866 19:58575572-58575594 CGCACTGCGACCCGAAGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1168724857_1168724866 12 Left 1168724857 19:58575537-58575559 CCGAAGCCCCGCCAGCCCAGCTA 0: 1
1: 0
2: 2
3: 21
4: 758
Right 1168724866 19:58575572-58575594 CGCACTGCGACCCGAAGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1168724859_1168724866 5 Left 1168724859 19:58575544-58575566 CCCGCCAGCCCAGCTAAAGCAGA 0: 1
1: 0
2: 1
3: 12
4: 242
Right 1168724866 19:58575572-58575594 CGCACTGCGACCCGAAGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1168724858_1168724866 6 Left 1168724858 19:58575543-58575565 CCCCGCCAGCCCAGCTAAAGCAG 0: 1
1: 0
2: 2
3: 20
4: 181
Right 1168724866 19:58575572-58575594 CGCACTGCGACCCGAAGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168724866 Original CRISPR CGCACTGCGACCCGAAGGTG AGG Intergenic