ID: 1168728745

View in Genome Browser
Species Human (GRCh38)
Location 19:58607242-58607264
Sequence CAAAGGCGGCGCGCCGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168728745_1168728754 29 Left 1168728745 19:58607242-58607264 CCTCCGCCGGCGCGCCGCCTTTG No data
Right 1168728754 19:58607294-58607316 ACACCCGGAGAGCATCGCGACGG No data
1168728745_1168728753 14 Left 1168728745 19:58607242-58607264 CCTCCGCCGGCGCGCCGCCTTTG No data
Right 1168728753 19:58607279-58607301 CGTTCTCTTTAGCACACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168728745 Original CRISPR CAAAGGCGGCGCGCCGGCGG AGG (reversed) Intergenic