ID: 1168731339

View in Genome Browser
Species Human (GRCh38)
Location 20:84173-84195
Sequence TGCCATTGGAGTATTGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168731339_1168731344 -7 Left 1168731339 20:84173-84195 CCTACCCCAATACTCCAATGGCA No data
Right 1168731344 20:84189-84211 AATGGCAGAGTATCTACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168731339 Original CRISPR TGCCATTGGAGTATTGGGGT AGG (reversed) Intergenic
No off target data available for this crispr