ID: 1168734328

View in Genome Browser
Species Human (GRCh38)
Location 20:116787-116809
Sequence ACCTGCTGGTAGAAGTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168734324_1168734328 13 Left 1168734324 20:116751-116773 CCAGTCTATAGGTCAAACTGGAC No data
Right 1168734328 20:116787-116809 ACCTGCTGGTAGAAGTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168734328 Original CRISPR ACCTGCTGGTAGAAGTGTGT AGG Intergenic
No off target data available for this crispr