ID: 1168740360

View in Genome Browser
Species Human (GRCh38)
Location 20:185026-185048
Sequence CCTACTTTGTAGAATGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168740360_1168740363 1 Left 1168740360 20:185026-185048 CCTAACTCATTCTACAAAGTAGG No data
Right 1168740363 20:185050-185072 ATCACCCTGGTACCAAAACCTGG 0: 3
1: 200
2: 2813
3: 8732
4: 6742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168740360 Original CRISPR CCTACTTTGTAGAATGAGTT AGG (reversed) Intergenic
No off target data available for this crispr