ID: 1168741239

View in Genome Browser
Species Human (GRCh38)
Location 20:193230-193252
Sequence TCTGCTTTCCCAAACACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168741239_1168741242 -9 Left 1168741239 20:193230-193252 CCTCTGGTGTTTGGGAAAGCAGA No data
Right 1168741242 20:193244-193266 GAAAGCAGAGTATACGGGTTAGG No data
1168741239_1168741244 0 Left 1168741239 20:193230-193252 CCTCTGGTGTTTGGGAAAGCAGA No data
Right 1168741244 20:193253-193275 GTATACGGGTTAGGTATAGGTGG No data
1168741239_1168741245 1 Left 1168741239 20:193230-193252 CCTCTGGTGTTTGGGAAAGCAGA No data
Right 1168741245 20:193254-193276 TATACGGGTTAGGTATAGGTGGG No data
1168741239_1168741246 6 Left 1168741239 20:193230-193252 CCTCTGGTGTTTGGGAAAGCAGA No data
Right 1168741246 20:193259-193281 GGGTTAGGTATAGGTGGGTATGG No data
1168741239_1168741247 17 Left 1168741239 20:193230-193252 CCTCTGGTGTTTGGGAAAGCAGA No data
Right 1168741247 20:193270-193292 AGGTGGGTATGGAGCGACAATGG No data
1168741239_1168741243 -3 Left 1168741239 20:193230-193252 CCTCTGGTGTTTGGGAAAGCAGA No data
Right 1168741243 20:193250-193272 AGAGTATACGGGTTAGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168741239 Original CRISPR TCTGCTTTCCCAAACACCAG AGG (reversed) Intergenic
No off target data available for this crispr