ID: 1168741247

View in Genome Browser
Species Human (GRCh38)
Location 20:193270-193292
Sequence AGGTGGGTATGGAGCGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168741236_1168741247 28 Left 1168741236 20:193219-193241 CCACTCTGCTTCCTCTGGTGTTT No data
Right 1168741247 20:193270-193292 AGGTGGGTATGGAGCGACAATGG No data
1168741239_1168741247 17 Left 1168741239 20:193230-193252 CCTCTGGTGTTTGGGAAAGCAGA No data
Right 1168741247 20:193270-193292 AGGTGGGTATGGAGCGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168741247 Original CRISPR AGGTGGGTATGGAGCGACAA TGG Intergenic
No off target data available for this crispr