ID: 1168743980

View in Genome Browser
Species Human (GRCh38)
Location 20:220320-220342
Sequence GGTCTTAAAGAGGATGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168743973_1168743980 26 Left 1168743973 20:220271-220293 CCTACAAAATGTAGAAAATAGTC No data
Right 1168743980 20:220320-220342 GGTCTTAAAGAGGATGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168743980 Original CRISPR GGTCTTAAAGAGGATGTAGA GGG Intergenic
No off target data available for this crispr