ID: 1168748203

View in Genome Browser
Species Human (GRCh38)
Location 20:263170-263192
Sequence AGGGAGAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168748198_1168748203 27 Left 1168748198 20:263120-263142 CCTCAGGCAGCAGCTGTGTGGTG No data
Right 1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168748203 Original CRISPR AGGGAGAGCACAGTGATTGT GGG Intergenic