ID: 1168748804

View in Genome Browser
Species Human (GRCh38)
Location 20:267530-267552
Sequence GCTTCTAGTGCCCCATTACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168748804 Original CRISPR GCTTCTAGTGCCCCATTACC CGG (reversed) Intergenic
902666237 1:17940845-17940867 GCTTCCAGGTCCCCTTTACCAGG + Intergenic
917213692 1:172656771-172656793 GCTCCTACTGCCTCCTTACCAGG - Intergenic
1068146017 10:53071587-53071609 CATTCTAGTGCTCCCTTACCAGG - Intergenic
1078867143 11:15308349-15308371 ACTTCTAGTACCCACTTACCTGG + Intergenic
1083482483 11:62958623-62958645 GCCTCTCGTGCTCCATTTCCTGG + Intronic
1089160144 11:116430969-116430991 GCTTCTGATGCCCCACTCCCAGG - Intergenic
1090642869 11:128744265-128744287 GATTCTACAGCCCCTTTACCTGG - Intronic
1092960840 12:13595542-13595564 GCTCCCAGAGCACCATTACCTGG - Intronic
1109030973 13:57186991-57187013 GCTTCTTCTCCCCCATTACATGG - Intergenic
1109912961 13:68940858-68940880 AGTTCTAGAGCCCAATTACCTGG + Intergenic
1110060430 13:71032887-71032909 GCCACTGGTGCCCCATTGCCTGG - Intergenic
1110531421 13:76602996-76603018 GCTGCTGGTGTCCCATCACCCGG + Intergenic
1114808466 14:25865378-25865400 GCTTCTACTGACCCACTTCCAGG + Intergenic
1117434715 14:55704931-55704953 GGTTCTAGTGTCACATTACCTGG - Intergenic
1125251691 15:37712548-37712570 ACTTCTGGTGCCCCACTACTTGG - Intergenic
1127876838 15:63119042-63119064 GCGTCTGGTGCCCCATTATTAGG - Intergenic
1129316951 15:74750801-74750823 TCTGCTAGGGCCCCATTTCCAGG - Intronic
1130143234 15:81250628-81250650 GCTGGTGGTGCCCCAATACCTGG - Intronic
1134865317 16:17601776-17601798 GCATCTGGGGCCCCATCACCTGG - Intergenic
1137819997 16:51435130-51435152 GCCTCTAGAGCCAGATTACCTGG - Intergenic
1139935442 16:70567432-70567454 GCTGCTATTGCCCCATTCCAGGG + Exonic
1148774352 17:50087315-50087337 GGTTCTGGAGCCACATTACCTGG - Intronic
1149030311 17:52075239-52075261 TCTTCTAGTGCACCATGCCCAGG - Intronic
1150144167 17:62753855-62753877 TGTTCTGGTTCCCCATTACCCGG + Intronic
1151857125 17:76729473-76729495 GCTTCTAGTGTCACAGTATCAGG - Intronic
1153862018 18:9221215-9221237 GCTTCAAGTTCCACATAACCAGG - Intronic
1156948027 18:42858697-42858719 GATTCTAATTCCCCATTATCTGG + Intronic
1157252275 18:46105319-46105341 GCTTCAAGTCCTCTATTACCAGG - Exonic
1167041174 19:47023301-47023323 GCGTCCAGCCCCCCATTACCTGG + Intronic
1168343613 19:55640303-55640325 GCCTCAAGTGCCCCAGGACCTGG + Intronic
926356474 2:12045273-12045295 GCTCCTAGTGGCCCATAATCTGG + Intergenic
926820692 2:16848597-16848619 AGGTCTAGTGCCCCCTTACCAGG + Intergenic
935160099 2:100522712-100522734 GACTCAAGTGCCCCAGTACCAGG + Intergenic
938758237 2:134400198-134400220 GCTTCTGGGGCACCTTTACCTGG + Intronic
939006242 2:136790978-136791000 CCTTCCAGTGCCCCAGTAGCTGG - Intronic
942268626 2:174251532-174251554 GATTCTAGTACTCCATGACCGGG - Intergenic
948449556 2:238060804-238060826 GCTTCTAGCGCCCGGTTCCCGGG + Intronic
948686991 2:239675942-239675964 GCTTCGAGGGCCCCATGAGCAGG - Intergenic
1168748804 20:267530-267552 GCTTCTAGTGCCCCATTACCCGG - Intergenic
1172889928 20:38256996-38257018 GCTTCCACTGCCCCACTCCCTGG + Intronic
1173996129 20:47339916-47339938 GCTTCTAGAGCCAGATTTCCTGG - Intronic
951777549 3:26326170-26326192 GCTTTGAGTGCCCCAGTAACAGG + Intergenic
951975046 3:28496914-28496936 GCTTCTAGAGCCCCTCTTCCTGG + Intronic
952251837 3:31663530-31663552 GCTTCTAGTGTCACATTTGCAGG + Intronic
953153682 3:40348275-40348297 GTTTCTAGGGCCCAATTAGCAGG - Intergenic
961232904 3:125335294-125335316 GCTTCTAGAGCCTGATTTCCTGG - Intronic
961811778 3:129526260-129526282 GCTGTTAGTTCCCCATCACCAGG + Intergenic
962448759 3:135493742-135493764 CCTCCCAGTGGCCCATTACCAGG + Intergenic
973773654 4:54227425-54227447 GCTTCTCGGGCCCCATTAAACGG + Intronic
978391815 4:108235218-108235240 GCTACTGGTGCCCCAGCACCTGG + Intergenic
978491559 4:109316231-109316253 CCTTCTAGTGCCCCAATATTGGG + Intergenic
986032729 5:3909137-3909159 GCTTCTGGTTCCCCATGGCCTGG + Intergenic
986220530 5:5765136-5765158 GCTTCTAATGCCAAATTACTGGG + Intergenic
989708865 5:44372210-44372232 GCTTCTGGTGCCACATTCCTTGG + Intronic
990970540 5:61501116-61501138 GCTTCTAGGTCCTCATTACTGGG + Intronic
996328560 5:122304673-122304695 GCTTCTAGTGCCAAATTCCCTGG - Intergenic
998255283 5:140581660-140581682 GCTTCAAGTCCTCTATTACCAGG - Intronic
1001227475 5:169957623-169957645 GCCTCTAGTGTCTCATTACCAGG - Intronic
1002018688 5:176347585-176347607 GCTTCTAGAGCCCTCTTTCCAGG - Exonic
1018494688 6:164337473-164337495 GCTTCTGGTGCCGCACTCCCTGG - Intergenic
1019730079 7:2624661-2624683 GCCTCCAGTGCCCCAATTCCAGG - Intergenic
1019824636 7:3273705-3273727 GCTTCTAGTGACCCATCCCTGGG - Intergenic
1023913600 7:44572203-44572225 GCTTTTAGTGCCTCAGGACCAGG + Intronic
1029112762 7:98222208-98222230 GCTCCAGCTGCCCCATTACCAGG + Intronic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1030080405 7:105773317-105773339 GCTTCTAGTGCCGTATGACTAGG - Intronic
1031999707 7:128256812-128256834 GGTTCCAGTCCCTCATTACCTGG - Exonic
1033228830 7:139581275-139581297 GCTCCTGGTGTCCCATTTCCAGG - Intronic
1037131172 8:15409429-15409451 GCTGTTAATGCCCTATTACCTGG - Intergenic
1039965589 8:42281421-42281443 GCTTCTATCGCACCTTTACCAGG + Intronic
1040532644 8:48277754-48277776 GCTTCTAGTGCCCCAGGCCTTGG + Intergenic
1041430919 8:57779836-57779858 GATTCTGGTGCCTGATTACCTGG - Intergenic
1042067764 8:64897703-64897725 GCATCTAGTGGCCCATGACAAGG + Intergenic
1049264614 8:141660782-141660804 GCTTCTGGGGCCCCAGTTCCAGG + Intergenic
1050111971 9:2226663-2226685 GCTTCTATAGCCCCAGCACCTGG - Intergenic
1059693945 9:116713214-116713236 GATTCTGGTGCCCCATACCCCGG + Intronic
1186801363 X:13095579-13095601 GCATCTAGTGCCTCATTAAATGG + Intergenic
1187029158 X:15467866-15467888 GCTTCTAGAACCCCAGGACCAGG + Intronic
1187388039 X:18865875-18865897 GCTTCAAGTCCTCTATTACCAGG - Intergenic
1190753226 X:53380240-53380262 GGGTCTAGTGCCCCAGGACCAGG + Intronic
1197929028 X:131677015-131677037 GCTTCTACTGTCCCAGTTCCAGG + Intergenic
1199618438 X:149677703-149677725 CCTTCTTCTGCCCCATCACCTGG - Intergenic
1199620028 X:149691571-149691593 GCTTATAATGCCTCATAACCTGG + Intronic
1199624204 X:149725546-149725568 CCTTCTTCTGCCCCATCACCTGG + Intergenic