ID: 1168749482

View in Genome Browser
Species Human (GRCh38)
Location 20:272338-272360
Sequence TACTGTCCAAGTCAACTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168749480_1168749482 3 Left 1168749480 20:272312-272334 CCTTGGCACCTCATATAAATCAA 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1168749482 20:272338-272360 TACTGTCCAAGTCAACTGTATGG 0: 1
1: 0
2: 0
3: 4
4: 80
1168749476_1168749482 19 Left 1168749476 20:272296-272318 CCACCCAATGACTCCACCTTGGC 0: 1
1: 0
2: 2
3: 17
4: 253
Right 1168749482 20:272338-272360 TACTGTCCAAGTCAACTGTATGG 0: 1
1: 0
2: 0
3: 4
4: 80
1168749478_1168749482 15 Left 1168749478 20:272300-272322 CCAATGACTCCACCTTGGCACCT 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1168749482 20:272338-272360 TACTGTCCAAGTCAACTGTATGG 0: 1
1: 0
2: 0
3: 4
4: 80
1168749477_1168749482 16 Left 1168749477 20:272299-272321 CCCAATGACTCCACCTTGGCACC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1168749482 20:272338-272360 TACTGTCCAAGTCAACTGTATGG 0: 1
1: 0
2: 0
3: 4
4: 80
1168749474_1168749482 20 Left 1168749474 20:272295-272317 CCCACCCAATGACTCCACCTTGG 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1168749482 20:272338-272360 TACTGTCCAAGTCAACTGTATGG 0: 1
1: 0
2: 0
3: 4
4: 80
1168749481_1168749482 -5 Left 1168749481 20:272320-272342 CCTCATATAAATCAAACTTACTG 0: 1
1: 0
2: 1
3: 14
4: 213
Right 1168749482 20:272338-272360 TACTGTCCAAGTCAACTGTATGG 0: 1
1: 0
2: 0
3: 4
4: 80
1168749479_1168749482 6 Left 1168749479 20:272309-272331 CCACCTTGGCACCTCATATAAAT 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1168749482 20:272338-272360 TACTGTCCAAGTCAACTGTATGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168749482 Original CRISPR TACTGTCCAAGTCAACTGTA TGG Intronic
906529235 1:46513705-46513727 TACTGTCCAAGGCAGGGGTACGG + Exonic
909187150 1:72502422-72502444 TACTGTTCATGTTTACTGTAAGG + Intergenic
913350865 1:117857480-117857502 TACTTTCAAAAACAACTGTAAGG - Intergenic
914503547 1:148268345-148268367 TACTTTCAAAGTAAACTGCAAGG - Intergenic
914510211 1:148325567-148325589 TACTTTCAAAGTAAACTGCAGGG + Intergenic
918012367 1:180599503-180599525 TACTTTCTAAGACATCTGTATGG + Intergenic
918229715 1:182516327-182516349 TCCTGTCCATATCATCTGTATGG + Intronic
1063039397 10:2321399-2321421 TATTGGCCAAGGAAACTGTAGGG - Intergenic
1067837241 10:49649209-49649231 TTCTCTCCAAGTCTTCTGTAAGG + Intronic
1078239507 11:9517821-9517843 TACAGTCCAAGTAATCTTTAAGG - Intronic
1080483300 11:32676153-32676175 TACTCTCTGAGTAAACTGTAAGG + Intronic
1083516999 11:63269218-63269240 TACTATCCCAGTCAACTTAATGG - Intronic
1094570849 12:31639874-31639896 TATTGTCCAGTCCAACTGTAAGG - Intergenic
1095629684 12:44360654-44360676 TACTGACCAAGGAAACTGTCAGG + Intronic
1096079589 12:48824798-48824820 TCCTGCCCAAGTGAACTGTGTGG + Intronic
1099672883 12:85717557-85717579 GAGTGTGCAAGTCAAATGTAGGG - Intergenic
1099768220 12:87018289-87018311 CAGTGTTCAAGTCAGCTGTATGG - Intergenic
1100967534 12:100029333-100029355 TACTGAACAAGTCAAGTATAAGG - Intronic
1101828208 12:108237148-108237170 TCCTGTCCCAGTAAACTCTAGGG + Intronic
1102165210 12:110800712-110800734 AACTGCACAAGACAACTGTAGGG + Intergenic
1109539260 13:63751002-63751024 TCCTGTCTAAATCAACTGTGTGG + Intergenic
1109544584 13:63828832-63828854 TCCTGTCTAAATCAACTGTGTGG - Intergenic
1110010856 13:70331763-70331785 TCCTCCCAAAGTCAACTGTATGG + Intergenic
1110301173 13:73928964-73928986 CACTCTCCAAGTAAACTGTGGGG + Intronic
1115325164 14:32129886-32129908 TACAGTCAAAGTGAACTGCATGG - Intronic
1115947452 14:38678024-38678046 TTCTGGTCAAGTAAACTGTATGG - Intergenic
1121180219 14:91923306-91923328 TAAAGCCCAAGTCAACTGCATGG + Intronic
1122642510 14:103168401-103168423 CACTGTCCAAGTCAACTGAGTGG - Intergenic
1126957775 15:53953421-53953443 TTCTGTCCAATTCAACCCTAAGG + Intergenic
1132051037 15:98607921-98607943 TGTAGTCCAAGTCAACTGTCTGG + Intergenic
1134399000 16:13891344-13891366 TACATTCCAAATCAACAGTAAGG + Intergenic
1138782271 16:59803413-59803435 TACTGTCCAAACCAAATCTATGG - Intergenic
1155705374 18:28803823-28803845 TACTGTCCAAGTTAAGCTTATGG - Intergenic
1157147640 18:45180974-45180996 CACTGTCCTAGCCAACTGGATGG + Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1165979741 19:39710242-39710264 TCCTGTCCAACTCAACACTAGGG + Intergenic
929944446 2:46360005-46360027 TGCTCACCAAGTCCACTGTAAGG + Intronic
930231435 2:48847682-48847704 TCCTGTCCAAGTGGACTTTAAGG + Intergenic
933859975 2:86456542-86456564 AACTCTTCAAGTCAACTGTGAGG + Exonic
937515815 2:122654222-122654244 TTCTGTACAAGGCAACTGAATGG + Intergenic
944814819 2:203364662-203364684 TTCTATCCTAGTCAACTATAAGG - Intronic
945274747 2:207977062-207977084 GACTGTCCAAAACAACTGGAAGG - Exonic
947153669 2:227138928-227138950 CAGTGTTCAAGTCAATTGTAGGG - Intronic
1168749482 20:272338-272360 TACTGTCCAAGTCAACTGTATGG + Intronic
1170280494 20:14641339-14641361 AGCTGTCAAAGTCATCTGTAAGG + Intronic
1170856940 20:20065566-20065588 CCCTGGCCAAGTCAACTGCAAGG + Intronic
1177891300 21:26807306-26807328 TACTGACCACGTCTACAGTATGG - Intergenic
952040819 3:29259269-29259291 TTTAGTCCAAGACAACTGTATGG + Intergenic
952045620 3:29315509-29315531 TAATTTCCAAGAAAACTGTAAGG + Intronic
953306624 3:41836589-41836611 GGCTGTCCAAGTGAACTGGATGG - Intronic
955109953 3:55938765-55938787 TGCTGTCAAAGTCAATTATACGG - Intronic
958738122 3:98033588-98033610 GACTGTACAAGTCTACTCTATGG + Intronic
959176308 3:102916127-102916149 TACCCTCCAAGTCAATTGTGTGG + Intergenic
959768788 3:110068178-110068200 TACTATCAAAGTCAAGTTTAAGG + Intergenic
962167605 3:133065936-133065958 TACTCTCTAAGTTAAGTGTAAGG + Intronic
963528786 3:146447533-146447555 TAGTGTCCTATTCTACTGTAGGG + Intronic
965022788 3:163255639-163255661 TACAATTCAATTCAACTGTAAGG - Intergenic
970615029 4:17760960-17760982 GACTGTGCAAATCAACTGTTGGG - Intronic
971727680 4:30334980-30335002 TACTATCCAAAGCAACTTTATGG - Intergenic
973037701 4:45426952-45426974 CACTGTACTAGTCACCTGTAAGG - Intergenic
976163311 4:82227295-82227317 TACTCTCCACCTCATCTGTAAGG + Intergenic
982727239 4:158918714-158918736 TACTGGCCACATCAACTGTGGGG + Intronic
983429397 4:167629173-167629195 TACTTTCTAAGTCAATTTTATGG - Intergenic
990965594 5:61443771-61443793 TACTTTTCAAGTAAACTGCAGGG - Intronic
993838186 5:92841450-92841472 TTCTGTCCAAGTCAATTCTCAGG - Intergenic
995388548 5:111614366-111614388 GACTGTCAAAGTCAACACTAGGG - Intergenic
995536612 5:113142970-113142992 TACTTTCCAGGGCTACTGTAAGG + Intronic
997143523 5:131408007-131408029 GTGTGTCCAAGTCTACTGTAAGG + Intergenic
1001042319 5:168345574-168345596 TACAATCCAAGTCAACTGCAAGG - Intronic
1002542245 5:179913912-179913934 TACTGTCCGAGGCAACTACAGGG - Intronic
1016208081 6:141494589-141494611 GACTGCCCAAGAGAACTGTAGGG - Intergenic
1018896881 6:168025600-168025622 TACTTCCCAAGTCAAGTCTAGGG - Intronic
1023632657 7:42179400-42179422 TGCTGCCCAAGGCCACTGTATGG + Intronic
1024141390 7:46466492-46466514 TACTGTCCAGGTTAACTGGATGG + Intergenic
1028948056 7:96603075-96603097 TACCTTCCAAGTGAACTGTCAGG - Intronic
1039586374 8:38710843-38710865 TACTGTCCAGGACAACTGGCTGG + Intergenic
1041498667 8:58515533-58515555 TACTGTATGATTCAACTGTATGG - Intergenic
1058941179 9:109814008-109814030 TAGGGTCAAAGTCAACTGCAGGG - Intronic
1061562597 9:131415605-131415627 AGCTGACCAAGTCAAGTGTAGGG - Intronic
1186771629 X:12823941-12823963 TCCTGTCCAATTCTACTGAATGG + Intronic
1192161292 X:68790024-68790046 TATCGTCCAAGGTAACTGTATGG + Intergenic
1193718195 X:84956871-84956893 TAGTTTCCAAGTCGACTTTAGGG + Intergenic
1193861168 X:86670056-86670078 AAATGTACAAATCAACTGTAAGG + Intronic
1196125623 X:112095739-112095761 TACTGACCAAGTCAAGGGTATGG + Intergenic
1201567487 Y:15382223-15382245 AACTGACAAAGTCCACTGTATGG + Intergenic