ID: 1168750923

View in Genome Browser
Species Human (GRCh38)
Location 20:280454-280476
Sequence CTTGCTCTGCAGGTGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168750917_1168750923 5 Left 1168750917 20:280426-280448 CCTCTACATGCCAGGCCAGGTGC No data
Right 1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG No data
1168750918_1168750923 -5 Left 1168750918 20:280436-280458 CCAGGCCAGGTGCTGTGCCTTGC No data
Right 1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG No data
1168750916_1168750923 6 Left 1168750916 20:280425-280447 CCCTCTACATGCCAGGCCAGGTG No data
Right 1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG No data
1168750919_1168750923 -10 Left 1168750919 20:280441-280463 CCAGGTGCTGTGCCTTGCTCTGC No data
Right 1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168750923 Original CRISPR CTTGCTCTGCAGGTGGCACA TGG Intronic