ID: 1168750923

View in Genome Browser
Species Human (GRCh38)
Location 20:280454-280476
Sequence CTTGCTCTGCAGGTGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 359}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168750917_1168750923 5 Left 1168750917 20:280426-280448 CCTCTACATGCCAGGCCAGGTGC 0: 1
1: 0
2: 1
3: 44
4: 475
Right 1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG 0: 1
1: 0
2: 2
3: 37
4: 359
1168750916_1168750923 6 Left 1168750916 20:280425-280447 CCCTCTACATGCCAGGCCAGGTG 0: 1
1: 0
2: 3
3: 48
4: 386
Right 1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG 0: 1
1: 0
2: 2
3: 37
4: 359
1168750919_1168750923 -10 Left 1168750919 20:280441-280463 CCAGGTGCTGTGCCTTGCTCTGC 0: 1
1: 0
2: 6
3: 40
4: 443
Right 1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG 0: 1
1: 0
2: 2
3: 37
4: 359
1168750918_1168750923 -5 Left 1168750918 20:280436-280458 CCAGGCCAGGTGCTGTGCCTTGC 0: 1
1: 0
2: 11
3: 105
4: 1408
Right 1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG 0: 1
1: 0
2: 2
3: 37
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168750923 Original CRISPR CTTGCTCTGCAGGTGGCACA TGG Intronic
900585050 1:3428643-3428665 CTGGTTCTGCAGGAGGCCCAGGG - Intronic
903864974 1:26391467-26391489 CCTGCCCTGCTGGTGCCACAAGG + Intergenic
904342491 1:29845825-29845847 CATCCTCTGCAGGTGGGACCAGG + Intergenic
910821536 1:91355180-91355202 CTTGCTTTGCAGTTACCACAAGG - Intronic
911370212 1:96987238-96987260 CTTGCTCCGCAGCTTGCAGATGG + Intergenic
912488459 1:110047677-110047699 GTTGGTCTGCAGGTGGCAGGAGG - Intronic
912954435 1:114144674-114144696 CTTGCTCAGAACTTGGCACATGG - Intronic
913375008 1:118141571-118141593 CTTGCTCTACACCTGGCAGAAGG - Intronic
913535507 1:119768366-119768388 CTAACACTGCAGTTGGCACAAGG + Intronic
915522622 1:156456795-156456817 CTGGCTCTGCCAGTGGCAGACGG - Intergenic
915793175 1:158697516-158697538 CTTGCTCTTCAGCTTGCAGATGG - Intergenic
917236819 1:172901585-172901607 ACTGATGTGCAGGTGGCACATGG + Intergenic
920417791 1:205810355-205810377 CCTGCTCTTCAGATGGCCCAGGG - Exonic
922494549 1:226046399-226046421 CTTGCTCTTCAGGTTGCGGACGG - Intergenic
923286063 1:232497105-232497127 CATACTCAGCAGGTGCCACAAGG + Intronic
923941047 1:238827658-238827680 CTTGCCTTGCACGTGGCCCATGG + Intergenic
1063458312 10:6200712-6200734 CTTGCTCTGCAGCAGGCAAAAGG - Intronic
1063961517 10:11309924-11309946 CCTGCTCTGGAGGTGGTGCAGGG + Intronic
1064031302 10:11885149-11885171 ATAGCTCTGCAAGTGTCACAGGG - Intergenic
1067011661 10:42720127-42720149 CTAGGACAGCAGGTGGCACAGGG - Intergenic
1067204204 10:44199623-44199645 ATTGCTCTGCAGGTGGGGCAAGG + Intergenic
1067311929 10:45121729-45121751 CTAGGACAGCAGGTGGCACAGGG + Intergenic
1067337150 10:45374821-45374843 CTCCTTCTGCAGGTCGCACAGGG + Intronic
1067475217 10:46560480-46560502 CTTTCTGTGGAGGTGGCACTGGG - Intergenic
1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG + Intronic
1068980487 10:63057761-63057783 CGTGCTCTGCAGGGAGCACCTGG - Intergenic
1069163540 10:65119593-65119615 CTTGCTCCTCAGCTGGCAGATGG + Intergenic
1070274509 10:74992726-74992748 CTTACTCTGCAAGCAGCACATGG - Intronic
1070312150 10:75281727-75281749 CTTGCTCTGGAGCTTACACATGG + Intergenic
1071479844 10:86056928-86056950 CCAGCTCTGCAGGAAGCACAAGG - Intronic
1071961058 10:90809228-90809250 ATTGCTAGGCAGGTGGCAGAGGG - Intronic
1073126784 10:101155849-101155871 CTTGCTCTGCAGGGAGCAGTTGG - Intergenic
1073922742 10:108478381-108478403 CTTACTCCTCATGTGGCACAAGG - Intergenic
1074854613 10:117464334-117464356 CTTGCTCAGCAGACTGCACAGGG + Intergenic
1075002552 10:118809144-118809166 CTTCCTGTGCAGGTGGCCAATGG + Intergenic
1075930394 10:126290109-126290131 CTTACTCTGAAGGTGCCAGAAGG + Intronic
1076209007 10:128625699-128625721 CTGGCTGTGCAGGGGACACAGGG + Intergenic
1076231253 10:128821653-128821675 ATTCTTCTGCAGATGGCACAAGG - Intergenic
1076272169 10:129163199-129163221 CGTGCTGTGCAGGTGCCTCATGG + Intergenic
1076298833 10:129409175-129409197 CTGCCTCTGAAGGTAGCACAGGG + Intergenic
1076367636 10:129932367-129932389 CTTGCTTGGCATGTGGCAAAGGG + Intronic
1076427544 10:130378522-130378544 CTTGCACAGCATCTGGCACAGGG - Intergenic
1076503752 10:130957778-130957800 CGGGCTCTGCAGGTGTCAGAAGG + Intergenic
1076570479 10:131429490-131429512 CTGGCTCTCCAGGTGCCAGAGGG - Intergenic
1076690829 10:132223170-132223192 CTGGCTCAGCATGTGGCCCAAGG + Intronic
1076861943 10:133141873-133141895 CCTGCTCTGCAGATGGCATCTGG + Intergenic
1078106240 11:8359778-8359800 TTTCCTGTGCAGTTGGCACAGGG + Intergenic
1078977555 11:16495560-16495582 CTTGAACCACAGGTGGCACATGG - Intronic
1079399933 11:20098653-20098675 CTTGCTCTGCAGGTGGCAAGTGG + Intronic
1079687594 11:23380129-23380151 CTTGCTCCTCAGGTTGCAGACGG - Intergenic
1079913670 11:26341676-26341698 CTTGCTCTGCAACTTGCAGACGG - Intronic
1081057234 11:38424990-38425012 CTTGCTCTTCAGCTTGCAGATGG + Intergenic
1081626397 11:44658555-44658577 CTGGGTCTGCAGGTGGAACTGGG - Intergenic
1083225093 11:61280053-61280075 CTTGCTCTGCAGTTGAATCAAGG - Intronic
1084667333 11:70583446-70583468 CTTGCTGTGCTGTAGGCACAGGG - Intronic
1084857911 11:72000643-72000665 CTGGCTCAGCTGGTGGTACATGG - Intronic
1085315215 11:75540585-75540607 CTAGCTCTGAAGCTAGCACAGGG - Intergenic
1085893038 11:80603642-80603664 CTAGCTCAGCACCTGGCACATGG - Intergenic
1085998154 11:81947449-81947471 CTTGCTCTTCAGCTTGCAGACGG + Intergenic
1086549240 11:88035509-88035531 CTTGCTCTTCAGCTGGCAGATGG - Intergenic
1087788663 11:102384388-102384410 CATGCTCTGCAAGGGGGACAAGG - Intergenic
1087994815 11:104792322-104792344 ATTGCTCTGCATTTGGCATAGGG + Intergenic
1088065299 11:105710419-105710441 CTTGCTGTGGTGGTGGCTCAGGG - Intronic
1088542357 11:110926285-110926307 CTTGCTCCTCAGCTGGCAGAAGG + Intergenic
1089005027 11:115084007-115084029 CTGGCTCTGCAGGCAGCAGATGG - Intergenic
1089011724 11:115137051-115137073 GCTTCTCTGCAGGTGGCCCAGGG - Intergenic
1089238242 11:117051335-117051357 CTGGTTCTCCAGGTTGCACATGG + Intronic
1089601695 11:119619727-119619749 GTTGCTGTGCATGAGGCACAAGG - Intergenic
1089747597 11:120628100-120628122 AATGCTCTGCTGGTGGCAGAGGG + Intronic
1090828958 11:130407687-130407709 CTTACTCTGCAGGAAGTACATGG + Intronic
1093663518 12:21785180-21785202 CTTGCTCCTCAGCTTGCACATGG - Intergenic
1096579218 12:52573658-52573680 CTTACTGTGCAGCTGGCAGAGGG - Exonic
1097042400 12:56163688-56163710 CTCACTGTGGAGGTGGCACAGGG + Exonic
1097051998 12:56229248-56229270 CTTGCTCTCCAGGGGACACTTGG - Exonic
1098089424 12:66885309-66885331 CCTGCTCTGCAGGTGCCAAGGGG - Intergenic
1098328757 12:69331066-69331088 CTAGCTCTGCAGGTGACCCAAGG - Intergenic
1098544584 12:71697439-71697461 CCTGCTCTGCTGGAGACACATGG + Exonic
1098558358 12:71844705-71844727 CTTGCTCTGTACCTGGCACATGG + Intronic
1098774961 12:74600843-74600865 CTTGCTCTTCAGCTTGCAGATGG - Intergenic
1100981164 12:100163924-100163946 CTGGCTCCGCGGGTGGCCCATGG - Intergenic
1101713750 12:107292568-107292590 CTCTCTCTTCAGGTGGCAGATGG - Intergenic
1104023809 12:125011775-125011797 TTTGCCCTCCAGGTGACACAGGG - Intronic
1104086141 12:125475675-125475697 CTTGCTCCTCAGCTTGCACATGG + Intronic
1106135091 13:26967907-26967929 TTATCACTGCAGGTGGCACAGGG - Intergenic
1106497351 13:30292427-30292449 CTTCCTTTGCAGGTGTTACATGG - Intronic
1107108023 13:36667632-36667654 CTCACTCTGCAGCTGGCGCAAGG + Intergenic
1107460614 13:40598214-40598236 CTGGCTCTTCAGGTGGAATATGG + Intronic
1107783321 13:43928066-43928088 CTTGCTCCTCAGCTTGCACATGG + Intergenic
1108149048 13:47512489-47512511 CTTGCTCTCCAGCTTGCAGACGG + Intergenic
1109826553 13:67728843-67728865 CTTCCTCTGCAGGTGGGACATGG - Intergenic
1110241138 13:73268483-73268505 ATGGCTCTGCAGGTTTCACAAGG + Intergenic
1111525020 13:89456949-89456971 CTTGCTCCTCAGGTTGCAGACGG + Intergenic
1111938452 13:94582854-94582876 CTTGCTCCTCAGCTGGCAGATGG + Intronic
1112115298 13:96345921-96345943 CCTGGGCTGCAGGTGGCCCATGG + Intronic
1112809102 13:103197024-103197046 CCTGCTTTGCAGGTGGGAGATGG + Intergenic
1114083104 14:19218637-19218659 CCTGCTCTGCAGGTCTCACAGGG - Intergenic
1115391686 14:32861210-32861232 CTTGCTCCTCAGGTTGCAGATGG + Intergenic
1117894487 14:60467689-60467711 CTTGCACTGAATGTGGTACATGG + Intronic
1118449611 14:65888262-65888284 CTTGCTCCTCAGCTTGCACATGG - Intergenic
1118862475 14:69675239-69675261 CTTGGTGTGCAGGTGGAAGAGGG + Intronic
1119032007 14:71200123-71200145 CTTGCACTCCACCTGGCACATGG - Intergenic
1119121825 14:72086570-72086592 ATTGCTCTGCAGAGGGCTCAGGG - Intronic
1119747430 14:77054134-77054156 CTTTCTCTCCAGGTGACACATGG + Intergenic
1120020708 14:79526629-79526651 CTGGCTCTGTATCTGGCACACGG - Intronic
1120183669 14:81370384-81370406 CTTTCTTTGCAGGTGGAATATGG - Intronic
1120655923 14:87189800-87189822 CTTGCTCCTCAGCTTGCACATGG + Intergenic
1121337247 14:93084991-93085013 CAGGGTCTGCAGGGGGCACAGGG - Intronic
1122111545 14:99506769-99506791 GTTGCTCTGCTGGTCTCACATGG + Exonic
1122202110 14:100128792-100128814 AGCGCTCTGCAGATGGCACAAGG - Intronic
1122599855 14:102915772-102915794 CTTGCTCTGCAGGTGACGAATGG + Intergenic
1122778417 14:104133335-104133357 CTTGCTCTGCAGCTGGGCCCTGG + Intergenic
1122838571 14:104443368-104443390 CCTGCTCTGCAGCTGCCACTGGG - Intergenic
1202894727 14_GL000194v1_random:405-427 CCTGCCCTGCAGGTCTCACAGGG - Intergenic
1123701400 15:22917169-22917191 CTGGCTCTGCAGGAGGGTCAGGG - Intronic
1123980614 15:25598835-25598857 CTTGCTCTGTAGGTAGAGCATGG - Intergenic
1124713105 15:32031009-32031031 CATGATCTGCAGGAGGCTCAGGG - Exonic
1126378355 15:48019399-48019421 CTTGCGCGGCACCTGGCACATGG - Intergenic
1127139518 15:55960579-55960601 CTTGCTCCGCAGCTTGCAGATGG + Intronic
1127357792 15:58217511-58217533 CCTGCTTTGGAGGTGGGACATGG - Intronic
1128446051 15:67761509-67761531 CTGGCAGTGCAGGTGGCAAATGG + Intronic
1129428004 15:75478846-75478868 CTTGCTCTGCAGTGGTCAAAGGG + Intronic
1131151807 15:90051993-90052015 CTTCCTCTGCAGGTGGTAGAAGG - Intronic
1131210871 15:90495232-90495254 CTTGCTTTGCACGTGGTTCATGG + Intronic
1131832133 15:96360750-96360772 CTTGCTCAGCGAGTGGCAGAGGG - Intergenic
1132739399 16:1403926-1403948 CTGGGCCTGCAGGTGGCCCATGG - Intronic
1133236231 16:4388626-4388648 CGTGCTCTGCAGGAGGCAAGAGG + Exonic
1133545239 16:6799898-6799920 CTTGCTCTTCAGTTTGCAGATGG + Intronic
1133979478 16:10622570-10622592 CTTGGTCTCCATATGGCACAGGG - Intergenic
1134030492 16:10988661-10988683 CTGCCTCTGGAGGTGGAACATGG - Intronic
1135414406 16:22257808-22257830 CTTGCTTTGCAAGTAGCAGAAGG - Intronic
1135911092 16:26561552-26561574 CCTGCTCTGCTGGTGGCTCCTGG - Intergenic
1137584072 16:49653587-49653609 CTTTCCCTGGAGGTGGCAAAGGG - Intronic
1137742530 16:50794443-50794465 TTTCTTCTGCATGTGGCACAGGG + Intronic
1139480594 16:67228483-67228505 CTTGCTCTGCAGTTGGCCCTGGG + Exonic
1139546570 16:67652675-67652697 CCAGCTTTGCAGGTTGCACAAGG - Intronic
1140133148 16:72182044-72182066 CTTGGGCTGCATGTGGCCCATGG + Intergenic
1142231570 16:88902542-88902564 CCTGCTCTCTGGGTGGCACAAGG - Intronic
1142348534 16:89569469-89569491 CCTTCTCTGGAGGTGGCCCAGGG + Intergenic
1146145665 17:30414019-30414041 CTGGCTCTGCAGCAGACACATGG - Intronic
1147591028 17:41683447-41683469 CTTGATCTGCAGCCTGCACAGGG - Intergenic
1151536800 17:74743547-74743569 AGGGCTATGCAGGTGGCACAGGG - Intronic
1152017740 17:77762846-77762868 CTGGCTCAGCAACTGGCACAAGG + Intergenic
1152017928 17:77764123-77764145 CTGGCTCAGCATCTGGCACAAGG + Intergenic
1152297208 17:79474991-79475013 CTTGCTCTGCCTGTGGGAGAGGG - Intronic
1152559632 17:81071532-81071554 CTTTCTCTGCTGGTGGAAGAGGG - Intronic
1152610346 17:81312171-81312193 CAAGCCCTGCAGATGGCACAGGG - Exonic
1153468621 18:5417386-5417408 TTTCCTCTGCAGGTGGCGGAGGG + Intronic
1154499807 18:14990312-14990334 CCTGCCCTGCAGGTCTCACAGGG - Intergenic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1156772162 18:40741779-40741801 CTTTGGCTGCAGGTGGTACAAGG - Intergenic
1156826763 18:41439301-41439323 CTTGCTCCTCAGCTTGCACATGG - Intergenic
1156890442 18:42184560-42184582 CTTGCTCCTCAGGTTGCAGATGG - Intergenic
1157283175 18:46359391-46359413 CCTCCTGAGCAGGTGGCACATGG + Intronic
1157632388 18:49111781-49111803 CTTGCTAGGCTGGTGGCAGAAGG + Intronic
1157654959 18:49376065-49376087 CTTGCTCCTCAGCTTGCACAGGG + Intronic
1158451226 18:57567265-57567287 CTTACTTTGGAGGTGCCACATGG + Intronic
1158866572 18:61643508-61643530 CTTCCTCTACAGGTGTCAGAGGG + Intergenic
1158993087 18:62890028-62890050 CTTGTTCTGTAGGGGGCACTTGG + Intronic
1159115966 18:64113667-64113689 CTTTCCCTGCAGGTGAAACAAGG - Intergenic
1159609734 18:70512131-70512153 CTTGCAAAGGAGGTGGCACATGG - Intergenic
1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG + Exonic
1161553713 19:4928657-4928679 CTTGCTGTTCAGGTGGGACAGGG + Intronic
1161597103 19:5156192-5156214 CTTGGGCAGCAGGTGGCCCAAGG - Intergenic
1163820098 19:19491689-19491711 CTTGCTCACAAGGTGGCACCAGG - Intronic
1164589754 19:29500204-29500226 CTTCCACTGCACGAGGCACATGG - Intergenic
1166896755 19:46027898-46027920 CTTGCTATCCTTGTGGCACAGGG + Intergenic
1167034116 19:46983387-46983409 CTTACTCTGTATGAGGCACACGG - Intronic
1167779618 19:51590698-51590720 CTTTCTCAGGAGGTGGGACATGG - Exonic
925144668 2:1572974-1572996 CTTGCCCTTCAGGAGGCAGAGGG - Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925261712 2:2535089-2535111 GTGGCTCAGCAGGTGGCACTGGG - Intergenic
925312012 2:2891289-2891311 CTTACTCTGCAGGCCCCACATGG + Intergenic
925329547 2:3047842-3047864 CTTGCTCTTCAGCTTGCAGATGG + Intergenic
925574733 2:5349130-5349152 CTCCTTCTGCAGATGGCACATGG - Intergenic
925704769 2:6673985-6674007 CTTGCTCTTCAGCTTGCAGATGG - Intergenic
925835175 2:7937888-7937910 CTTGCTCTTCAGCTTGCAGATGG + Intergenic
926388576 2:12363298-12363320 CTTGCTCCTCAGCTTGCACATGG + Intergenic
928190525 2:29161675-29161697 CTGGCTGTGCAGGTGACACCTGG - Intronic
928786034 2:34887516-34887538 CTTGCACCGTAGGTGCCACAGGG - Intergenic
930007166 2:46907179-46907201 CTTGCTCTGCAGTTTGAATACGG + Intronic
930277958 2:49335744-49335766 CCTGCTCTGCTGGAGGAACAGGG + Intergenic
930848948 2:55937308-55937330 CTTGCTCTTCAGCTTGCAGAAGG - Intergenic
931755865 2:65373750-65373772 GTAGCTCTGCATTTGGCACATGG + Intronic
932372488 2:71202846-71202868 CTTTCTAGGCAGGTGGGACAGGG + Intronic
936092466 2:109510305-109510327 CTCCCTCTGTTGGTGGCACAGGG + Intergenic
938493474 2:131777998-131778020 CGTGCCCTGCAGGTCTCACAGGG + Intergenic
938499015 2:131820667-131820689 CCTGCCCTGCAGGTCTCACAGGG - Intergenic
939086090 2:137720224-137720246 CTTGCTCTTCAGCTTGCAGATGG + Intergenic
939677696 2:145093150-145093172 CTTGCTCTTCAGCTTGCAGATGG - Intergenic
940262068 2:151791326-151791348 CTTGCACTGAAGGTTGCAAATGG + Intronic
941646928 2:168050595-168050617 CTGGCTTTGCAGATGGCAGAAGG + Intronic
941916322 2:170816221-170816243 TTTTCTCTGCCGGTGGCACTGGG + Intronic
942093299 2:172514593-172514615 CCAGCTCTGCAGGTGGCCCACGG + Intergenic
942318973 2:174719127-174719149 CTAGCACTGCAGGTGGCTCTGGG + Intergenic
942825383 2:180169373-180169395 CATGCTCTGCATGTGAGACATGG - Intergenic
942950981 2:181721267-181721289 CTTGATCTCCAGATGGCACCTGG - Intergenic
944422275 2:199544208-199544230 CTTGCTCCTCAGCTGGCAGATGG - Intergenic
946790500 2:223296335-223296357 CTTGCTCTTCAGCTTGCAAAGGG + Intergenic
947647475 2:231754244-231754266 TTTACTCTGCAGTTGGTACATGG - Intronic
948275702 2:236706357-236706379 CTTGCTCTGCTCTTGGCAGAGGG + Intergenic
948632843 2:239313010-239313032 CTTGCTCTGCAGGCTGCCCCCGG - Intronic
948897725 2:240935051-240935073 CTGGCTCTCCAGGTGAGACAAGG + Intronic
948976845 2:241468665-241468687 ATTGCCCTGCAGGAGTCACAGGG + Intronic
1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG + Intronic
1169360920 20:4948233-4948255 CTTTCTCTGCAGGTGAAAGAAGG - Intronic
1170064131 20:12292360-12292382 CTTGTTCTCCTGGTGGCAGAAGG - Intergenic
1171269083 20:23799465-23799487 CAGGCTCTGCAGGTGGCCCTGGG + Intergenic
1171293182 20:23994229-23994251 CTGACTCTACAGGTGGGACAGGG - Intergenic
1172660212 20:36562901-36562923 ATGGCTCTGCAGGAGGCAGAGGG + Intergenic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1173793740 20:45844306-45844328 CATTCTCTGCAGCTGGCTCAGGG + Exonic
1173800401 20:45891340-45891362 CTTGCTCTCCAGGAGGCGCCCGG - Exonic
1174119870 20:48256765-48256787 CTATCTCTGCTGGTGCCACAGGG + Intergenic
1174527097 20:51181474-51181496 CTTCCCCTGCAATTGGCACAGGG + Intergenic
1175775032 20:61647731-61647753 CTTGCTCTGTAGGTACCACGGGG + Intronic
1176614426 21:9016392-9016414 CCTGCCCTGCAGGTCTCACAGGG - Intergenic
1177538328 21:22458683-22458705 CTTGCTCTTCAGCTTGCAGATGG + Intergenic
1177555399 21:22681778-22681800 CTTGCTCTTCAGCTTGCAGATGG + Intergenic
1177775533 21:25562200-25562222 CTTGCTCTGCGGGCGGCTCGGGG - Intergenic
1178910915 21:36672745-36672767 CTTGCTCTTCAGCTTGCAGACGG + Intergenic
1180396324 22:12346435-12346457 TTTCCTCTGTAGGTGGCAAAGGG + Intergenic
1180403388 22:12517656-12517678 TTTCCTCTGTAGGTGGCAAAGGG - Intergenic
1180497675 22:15904044-15904066 CCTGCTCTGCAGGTCTCACAGGG + Intergenic
1180824241 22:18851943-18851965 CTGACTCTGCAGGTGGGACAGGG - Intronic
1181124669 22:20695097-20695119 CTGACTCTGCAGGTGGGACAGGG - Intergenic
1181188495 22:21122605-21122627 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1181210705 22:21287888-21287910 CTGACTCTGCAGGTGGGACAGGG - Intergenic
1181398805 22:22639000-22639022 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1181501536 22:23318356-23318378 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1181650617 22:24257059-24257081 CTGACTCTGCAGGTGGGACAGGG - Intergenic
1181706764 22:24653679-24653701 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1182112636 22:27734274-27734296 GTTGCTCTGCAGCTGCCAGAAGG - Intergenic
1182791383 22:32955967-32955989 CTTGCTCTTCAGATTGCAGATGG + Intronic
1182966024 22:34521749-34521771 CTTACTCTTCAGGTTGCAGATGG + Intergenic
1183927579 22:41217028-41217050 CTACCTCTGCAGGTCCCACAGGG + Intronic
1184249409 22:43251593-43251615 CTGGCTCTGCAGGTGGAGAAGGG + Intronic
1184332709 22:43836149-43836171 CTCACACTGCAGGTGCCACAGGG + Intronic
1184332740 22:43836317-43836339 CTCACACTGCAGGTGCCACAGGG + Intronic
1184332755 22:43836401-43836423 CTCACACTGCAGGTGCCACAGGG + Intronic
1184332762 22:43836443-43836465 CTCACACTGCAGGTGCCACAGGG + Intronic
1184332776 22:43836527-43836549 CTCACACTGCAGGTGCCACAGGG + Intronic
1184332790 22:43836611-43836633 CTCACACTGCAGGTGCCACAGGG + Intronic
1184332809 22:43836731-43836753 CTCACACTGCAGGTGCCACAGGG + Intronic
1184332816 22:43836773-43836795 CTCACACTGCAGGTGCCACAGGG + Intronic
1184332823 22:43836815-43836837 CTCACACTGCAGGTGCCACAGGG + Intronic
1184332831 22:43836857-43836879 CTGACACTGCAGGTGCCACAGGG + Intronic
1184383014 22:44157970-44157992 CTTTCTCTGCAGTTTGCAGATGG + Exonic
1185051229 22:48555341-48555363 CTTGCTCTGCTGGTGAGACAGGG - Intronic
1203216242 22_KI270731v1_random:7542-7564 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1203274378 22_KI270734v1_random:77847-77869 CTGACTCTGCAGGTGGGACAGGG - Intergenic
1203294753 22_KI270736v1_random:31185-31207 CTTGCTATGCTGTTTGCACATGG + Intergenic
949325443 3:2858245-2858267 CTTATTCTGGAGGTGGAACAGGG - Intronic
949563137 3:5221081-5221103 CTTGCTCCACAGATGGCAAAGGG - Intergenic
950924653 3:16728465-16728487 CTGCCTCTGGAGGTGCCACAGGG - Intergenic
951540379 3:23776513-23776535 CTTGCCCTCCATGTGGCAGATGG + Intergenic
951786734 3:26428788-26428810 CTGGCTTTGAAGGTGGAACAAGG + Intergenic
952419401 3:33117820-33117842 CAGGCTCTGCAGCTGGAACATGG - Intronic
953180666 3:40591488-40591510 CTTGCTCTTCAGCTTGCACATGG - Intergenic
953390032 3:42528514-42528536 CTGGCTATGCAGGTGGCAGATGG - Intronic
953861304 3:46546174-46546196 CTTGGTCTTCACGTGGCCCAAGG + Intronic
954303255 3:49712462-49712484 CTTCTCCTGCAGGAGGCACACGG - Exonic
954554521 3:51507444-51507466 CTTGGTCTGGAGGAGACACATGG - Intergenic
955341878 3:58131224-58131246 GTTGCTCTGGATGTGGCAGATGG + Intronic
955500347 3:59577187-59577209 CTTCCTCAGCAGGTGTCTCATGG + Intergenic
955506939 3:59641839-59641861 CTTTCTCTGCAGGCTCCACATGG + Intergenic
955817439 3:62860489-62860511 CTTCCTATGCAGGTTCCACAGGG - Intronic
956352801 3:68356365-68356387 CAAGCTCAGCAGGTAGCACAAGG + Intronic
957322623 3:78651894-78651916 CTTGGTCCTCAGGTGACACAGGG + Exonic
957912180 3:86634358-86634380 CATACTCTGCAGTGGGCACAAGG + Intergenic
958103964 3:89049294-89049316 CTTCCCCTGCTGGTGGGACAAGG + Intergenic
960047757 3:113213281-113213303 GTGCATCTGCAGGTGGCACAAGG - Intronic
960855131 3:122094895-122094917 GTGCCTCTGCAGGTGGCACTAGG - Intronic
960861094 3:122154315-122154337 CCAGGCCTGCAGGTGGCACATGG - Intergenic
960966862 3:123111441-123111463 CATCCTCTGCAGGTGCCACCTGG + Intronic
961718745 3:128878127-128878149 AGTGCTCTGAACGTGGCACATGG - Intergenic
963369421 3:144379418-144379440 CTTGCTCCTCAGGTTGCAGACGG - Intergenic
965029081 3:163340610-163340632 CTTGCTCTTCAGTTTGCAGATGG - Intergenic
965543868 3:169896057-169896079 CTGGTACTGCAGGTGGCACTTGG + Intergenic
965930181 3:174032705-174032727 TTTCCTCTGCTGGGGGCACAAGG - Intronic
966851872 3:184169834-184169856 CTGGCTCTGGTGGTGGCAAAGGG + Intronic
967841443 3:194008123-194008145 CTTGCTCCTCAGCTGGCAGAGGG + Intergenic
969675359 4:8611455-8611477 CTTCCACTGCAGTTGGCAGAGGG - Intronic
969682860 4:8652813-8652835 CTTGCTCTGCTGTGGGGACATGG - Intergenic
970594153 4:17584564-17584586 CTTGCTTTGCAGTTAGCACTTGG + Intronic
971664147 4:29459985-29460007 CTTGCTCCGCAGCTTGCAGATGG + Intergenic
971803361 4:31321359-31321381 CTTGCTCTTCAGCTTGCAGACGG - Intergenic
972921500 4:43947905-43947927 CTTGCTCTTCAGCTTGCAGACGG + Intergenic
973809743 4:54558140-54558162 CTGGCTAAGCAGGTGGGACATGG - Intergenic
974500141 4:62689005-62689027 CTTGCTCCTCAGGTTGCACATGG - Intergenic
976759492 4:88532998-88533020 CTTGCTCTTCAGCTTGCAGATGG - Intronic
976921129 4:90444379-90444401 ATTGTTATGGAGGTGGCACAGGG - Intronic
978309795 4:107373903-107373925 CTTGCTCCTCAGCTGGCAGACGG + Intergenic
979919237 4:126477909-126477931 CTGGGTCTGCAGCTTGCACACGG + Intergenic
979945524 4:126826462-126826484 CTTGCTCTTCAGCTTGCAGATGG + Intergenic
980495871 4:133587137-133587159 GTTGCTCTGCAAGTGGCAGAGGG + Intergenic
981045732 4:140263437-140263459 GCTGCTCTGCACGTGGCTCAGGG - Intronic
983398918 4:167237999-167238021 CTGGCTCTGTGTGTGGCACATGG - Intergenic
985185654 4:187312501-187312523 CCTGCTCTTCAGGTGACAGATGG + Intergenic
985552872 5:542143-542165 CTTGCCCTGCACGTGGGACCAGG - Intergenic
985559223 5:574070-574092 CCTGCTCTGGAGGATGCACAGGG - Intergenic
987125183 5:14805296-14805318 CTTGCTCCTCAGCTGGCAGATGG + Intronic
987422235 5:17734342-17734364 CTGGCTCTGAAGTTGGCAAAGGG - Intergenic
987560904 5:19518769-19518791 CTTGCTCCTCAGCTTGCACAGGG + Intronic
989133162 5:38127026-38127048 GTTGCTCAGCAGGTGGCAGGTGG + Intergenic
989486048 5:41993720-41993742 CTTGCTCCTCAGCTTGCACATGG - Intergenic
990086568 5:51985978-51986000 CTTGTTCTCCAGGTATCACATGG - Intergenic
993094348 5:83464445-83464467 CCTGGGCTGCTGGTGGCACATGG + Intergenic
994358821 5:98826797-98826819 CTTGCTCTTCAGCTTGCAGATGG - Intergenic
996273819 5:121640343-121640365 CTTGCTCTGCAATTGGGAAAGGG + Intergenic
996667669 5:126079619-126079641 CTTTCTCTGGAGGTAGCTCAGGG - Intergenic
997473826 5:134131437-134131459 TCTGCTCTGGAGGTAGCACAAGG + Intronic
998510475 5:142709565-142709587 CTTGCTCCTCAGGTTGCAGATGG + Intergenic
1000024551 5:157347423-157347445 GTTGCTCTGCAGCTTGCCCATGG + Intronic
1001078926 5:168652609-168652631 CCTGCTTTGCAGGTGGAACCTGG + Intergenic
1001751074 5:174131862-174131884 CTTTCTCTGCAGGTTTCAGAAGG + Intronic
1003967122 6:11263531-11263553 CTTGAACTGCAGGGAGCACATGG + Intronic
1004153907 6:13149740-13149762 CTTGGGCTGCATGTGGCCCAGGG - Intronic
1007241486 6:40429375-40429397 CCAGCTCTGCAGTTTGCACAGGG - Intronic
1011504585 6:88028025-88028047 CATGCTCTGGATGTGGGACATGG - Intergenic
1015885336 6:137911870-137911892 CTCGCACTGCAGATGGCACCTGG - Intergenic
1017221673 6:151972778-151972800 CTTGCTCTTCAGCTTGCAGACGG - Intronic
1017371670 6:153717095-153717117 CTTTCTCTGAAGGTGACAGATGG + Intergenic
1018046666 6:159971287-159971309 CTTCATCTCCAGGTGGAACACGG + Intronic
1018409659 6:163531251-163531273 CTTGCTCTGCATTTGGAGCAGGG + Intronic
1018425612 6:163677638-163677660 CTTACTCTGCAGCTTGCAGACGG + Intergenic
1019161213 6:170068029-170068051 CTGTCTCTGCAGATGGGACAGGG + Intergenic
1020022468 7:4877478-4877500 CTCGCTCTGCAGGAGGCAGTCGG - Intronic
1021785918 7:24152451-24152473 CCAGTTCTCCAGGTGGCACATGG + Intergenic
1022602365 7:31773359-31773381 CTTGCTCTGCTGGGGACCCAGGG - Intronic
1022969769 7:35506058-35506080 CTTACTCTGCAGCAGGCACCAGG + Intergenic
1023233414 7:38058047-38058069 CATGCTCGGCAGGGGGCATATGG - Intergenic
1024291730 7:47809729-47809751 CTTGCTCTTCAGTAGGCACTTGG + Intronic
1024575472 7:50760038-50760060 CTTGCTCGGCTGGTGGCTCCTGG - Intronic
1025035877 7:55592251-55592273 CTTGTTCTGCAGGGTACACATGG + Intergenic
1027909756 7:84234975-84234997 TTTACTCTGCATGTGGCATAAGG + Intronic
1028136471 7:87228199-87228221 CTTGGACTGCATGTGGCCCATGG + Intergenic
1029743364 7:102503510-102503532 CTTGCTCTGGGGGTGGCAGGGGG + Intronic
1029761353 7:102602671-102602693 CTTGCTCTGGGGGTGGCAGGGGG + Intronic
1030090066 7:105850616-105850638 CTCGTTCTTCAGGAGGCACAGGG - Intronic
1030507036 7:110437444-110437466 CTTGCTCTTCAGCTTGCAGAAGG + Intergenic
1030579357 7:111333831-111333853 CTTGCTCCGCAGCTTGCAGATGG + Intronic
1032602800 7:133317533-133317555 TTTGCTCTGAAGGTTGCAAAGGG - Intronic
1032655206 7:133921068-133921090 CTTGTTCTGCAGCTGGCAAATGG - Intronic
1032979128 7:137261856-137261878 CTTTCTCTGCATGTGGGGCAGGG + Intronic
1033076594 7:138255689-138255711 CTTGCTCTTCAGCTTGCAGATGG + Intergenic
1033259363 7:139829295-139829317 CGTGCTCTGCAGGTAGAAAAGGG - Exonic
1034425071 7:151009848-151009870 CTTGCTCTGGAGCTGGCACTGGG + Intronic
1035284329 7:157796651-157796673 AGAGCTCTGCAGGTTGCACAGGG + Intronic
1035328991 7:158084301-158084323 TCTGCTGTGCAGGTGGCAGATGG + Intronic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1035599751 8:890666-890688 GTGGCTCTGCTGGTGGCACCGGG - Intergenic
1036523876 8:9517399-9517421 CTTGCTCTGGTGGGAGCACACGG + Intergenic
1036757706 8:11482255-11482277 CTTCCCCTGCAGGTGGCTCTGGG + Intergenic
1037494857 8:19428752-19428774 CTGGCTCTGCAGAGGACACAAGG + Intronic
1038088501 8:24227437-24227459 CTTGCTCTTCAGCTTGCAGATGG - Intergenic
1039228556 8:35418067-35418089 CTCACTCTGCAGGGGGCTCAGGG - Intronic
1040578531 8:48675701-48675723 CTTGTTCTCCAGATGGTACACGG + Intergenic
1040793794 8:51267625-51267647 CTTGCTCCTCAGGTTGCAGATGG - Intergenic
1040860248 8:51991332-51991354 ATGGCTCTGCAGGTTGGACAAGG - Intergenic
1041691627 8:60693394-60693416 CTCTCTCTGCAGGTGCCCCAAGG - Intronic
1043733158 8:83711092-83711114 CTTGCTTTTCAGCTGGCACAGGG - Intergenic
1044634821 8:94311819-94311841 CTTCCCCTGGAGGTGGGACAAGG - Intergenic
1046744760 8:117864839-117864861 TCTGGTCTGCATGTGGCACAAGG + Intronic
1047071463 8:121348801-121348823 CTCTCTCTGCAGCTGGCACGTGG - Intergenic
1047844587 8:128792297-128792319 CTTGCTCCTCAGCTTGCACATGG - Intergenic
1048668552 8:136691305-136691327 CTTGCTTTGCAGGGGCCAAATGG - Intergenic
1049014247 8:139908321-139908343 CTTGCTCTGCATGGGGCGCCCGG + Intronic
1049249996 8:141583109-141583131 CTTGGTCTGGAGGCGGCTCAGGG - Intergenic
1049446876 8:142635246-142635268 CTGGCTCTGCATCTGACACAGGG + Intergenic
1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG + Intergenic
1050596913 9:7213331-7213353 CTAGCTCTGCAGATTGCAAAAGG + Intergenic
1050836557 9:10087667-10087689 CTTGCTTTGAAGGTGGAACCGGG + Intronic
1052518713 9:29514989-29515011 CCTGCTCTGCAGGTGGAACCTGG + Intergenic
1054328733 9:63731125-63731147 CCTGCCCTGCAGGTCTCACAGGG + Intergenic
1055903994 9:81271578-81271600 CTTGCTCTTCAGCTTGCAGATGG - Intergenic
1058110718 9:101028779-101028801 CTGGCGCTGCAGCTTGCACAGGG - Exonic
1058229442 9:102407839-102407861 CTTGCTCCTCAGCTGGCAGACGG + Intergenic
1058258944 9:102806965-102806987 CTTGCTCTTCAGCTTGCAGAGGG - Intergenic
1059894187 9:118842007-118842029 CTGGCTCTGAAGATGGAACAAGG - Intergenic
1060654546 9:125360764-125360786 CATTCTGAGCAGGTGGCACAGGG + Intronic
1061318005 9:129809330-129809352 CTTGTTCTGCAGGTGGCCTGTGG + Exonic
1062543496 9:137051824-137051846 CTTGGTCTCCGGGTGGCACCTGG - Intronic
1186056301 X:5653302-5653324 CTTGCTTTGCAGGAGGCTCCAGG + Intergenic
1186103310 X:6179695-6179717 ATTGGGCTGCAGGTGGCAAATGG - Intronic
1186294829 X:8137737-8137759 CTTGCTCTTCAGCTTGCAGACGG - Intergenic
1189222140 X:39381682-39381704 CTTGCTCAGCTGCTGGCCCAGGG - Intergenic
1189311565 X:40022210-40022232 CTTGCTTTGGAGGTGGGAAAAGG - Intergenic
1190006071 X:46739407-46739429 CTTGCTCTGCACATGTCACAGGG + Intronic
1191718901 X:64212957-64212979 CTTGCTCCTCAGCTTGCACACGG - Intergenic
1192436928 X:71148737-71148759 GCTGCTCTGCAGGCGGCACATGG - Intronic
1192661240 X:73045035-73045057 CTTGCTCTTCAGCTTGCAGATGG - Intergenic
1193819729 X:86147734-86147756 CTTGCTCTGTGGGTGGCAGATGG - Intergenic
1194026460 X:88758272-88758294 CTTGCTCTTCAAGTCACACAAGG - Intergenic
1195004196 X:100670482-100670504 ATTGCTGTGCAGGCTGCACAGGG - Intronic
1196500090 X:116370788-116370810 ATTGCTTTCCAGGTGGCAGATGG + Intergenic
1196605440 X:117652241-117652263 CTTGCTCTTCAGCTTGCAGATGG + Intergenic
1196772349 X:119307671-119307693 CTTGCTCTTCAGCTTGCAGACGG + Intergenic
1197992064 X:132329048-132329070 CTACCTCTCCAGGAGGCACATGG - Intergenic
1200651254 Y:5844352-5844374 CTTGCTCTGCGGCTTGCAGATGG + Intergenic