ID: 1168751059

View in Genome Browser
Species Human (GRCh38)
Location 20:281733-281755
Sequence CTTTGGAAGAGCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37807
Summary {0: 1, 1: 5, 2: 189, 3: 3743, 4: 33869}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168751054_1168751059 -8 Left 1168751054 20:281718-281740 CCTGTAATCCCAGCACTTTGGAA 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
Right 1168751059 20:281733-281755 CTTTGGAAGAGCAAGGTGGAAGG 0: 1
1: 5
2: 189
3: 3743
4: 33869

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168751059 Original CRISPR CTTTGGAAGAGCAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr