ID: 1168757314

View in Genome Browser
Species Human (GRCh38)
Location 20:326288-326310
Sequence GCGCGGCCCCGCCCCCCCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 6, 3: 62, 4: 334}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168757301_1168757314 28 Left 1168757301 20:326237-326259 CCGGACTACAAGTACCGGCCGCG 0: 2
1: 7
2: 5
3: 2
4: 16
Right 1168757314 20:326288-326310 GCGCGGCCCCGCCCCCCCGGTGG 0: 1
1: 0
2: 6
3: 62
4: 334
1168757307_1168757314 10 Left 1168757307 20:326255-326277 CCGCGCAAAAAGAGCAAGGGGGC 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1168757314 20:326288-326310 GCGCGGCCCCGCCCCCCCGGTGG 0: 1
1: 0
2: 6
3: 62
4: 334
1168757300_1168757314 29 Left 1168757300 20:326236-326258 CCCGGACTACAAGTACCGGCCGC 0: 1
1: 2
2: 6
3: 30
4: 432
Right 1168757314 20:326288-326310 GCGCGGCCCCGCCCCCCCGGTGG 0: 1
1: 0
2: 6
3: 62
4: 334
1168757302_1168757314 14 Left 1168757302 20:326251-326273 CCGGCCGCGCAAAAAGAGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 169
Right 1168757314 20:326288-326310 GCGCGGCCCCGCCCCCCCGGTGG 0: 1
1: 0
2: 6
3: 62
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168757314 Original CRISPR GCGCGGCCCCGCCCCCCCGG TGG Exonic
900105416 1:978936-978958 CCCAGGCCCCGCCCCCTCGGAGG + Exonic
900125896 1:1068850-1068872 GGGCGCCCCCGCCCACCCGATGG - Intergenic
900284579 1:1892942-1892964 CCGAGGCCCCGCCCCCACAGGGG + Intergenic
900335449 1:2160840-2160862 GAGACGCCCCGCCCCGCCGGGGG + Intronic
900376030 1:2355268-2355290 GCGCGGGCCGGGCCCCCCGTGGG + Intronic
900671433 1:3857232-3857254 GCGCGACCCCGCCCCACCCCAGG + Intergenic
901525973 1:9823706-9823728 GCGCCGCCCCGCTCCCGCGCTGG - Exonic
902286061 1:15409636-15409658 GCCCGGCCCCGGCCCCCAGCAGG + Intergenic
902375133 1:16026921-16026943 GCCCCGCCCCGCCGCCCCCGGGG - Intronic
903184671 1:21622424-21622446 GCCCGGCCCGGCCCCCGCCGGGG + Intronic
903263387 1:22142999-22143021 GCGCGCCCCGGCCCGCCCGCGGG - Intronic
903795119 1:25922921-25922943 GCGCGGCCGCGTGCGCCCGGGGG - Intergenic
905448766 1:38044429-38044451 GCGCGGCCCCTGCTCCCCGCGGG - Exonic
905734357 1:40315636-40315658 GGGGGGCCCCGCTCTCCCGGTGG + Exonic
906069635 1:43007573-43007595 GGGCAGCCCCGCCCCGCCGCCGG + Intergenic
908501277 1:64745451-64745473 GCGCCGCCCCGCCGCCCCTCGGG - Intronic
908555603 1:65254353-65254375 GCCCGGCTCCGCCCACACGGCGG - Intronic
912381280 1:109249554-109249576 GCGCTCCCTCGCCTCCCCGGCGG - Intergenic
912800187 1:112715326-112715348 CCGCGGCCCCGCCCCCGCCCAGG + Exonic
914869058 1:151458625-151458647 GCACGGCCTCGCCCCCTCGCCGG + Intronic
916528181 1:165631151-165631173 GCGCGGCCACGCCCCCAAGGCGG - Exonic
916535372 1:165698596-165698618 CCGCGGCCCCGCCCCTCCCGCGG - Exonic
916535381 1:165698613-165698635 CCGCGGCCCCGCCCCTCCCGCGG - Exonic
916588482 1:166167178-166167200 GCTCGGCCTCACCCACCCGGTGG - Intergenic
919403227 1:197146355-197146377 GCGGGGCCCCGCAGCCCCGCGGG + Exonic
919465948 1:197921684-197921706 GCGCAGCCCCGGCCTCCCTGAGG + Intronic
919712321 1:200739759-200739781 GCGTGGCCTCGCCACCACGGGGG - Exonic
919739257 1:200972485-200972507 GAGCGCCCCCGCCTTCCCGGGGG + Intronic
919878904 1:201889365-201889387 GCTCGGCCCCACTCCCCCGGCGG - Intronic
921599287 1:217089724-217089746 GGCCGGCCCCGCGCCCGCGGGGG - Intronic
922504979 1:226121298-226121320 AGGCGGCCCCGCCGCCCCTGAGG - Intergenic
923429348 1:233905409-233905431 GCGCGGCCGGGGCCCTCCGGGGG - Intronic
923461724 1:234214580-234214602 GCGCGGCCGCCTCGCCCCGGGGG + Intronic
923505302 1:234600240-234600262 GCCCCGCCCCGCCCCGCCCGGGG + Intergenic
924613171 1:245590292-245590314 GCGGGGCCCAGCCGCCCCGGGGG - Intronic
1063692027 10:8296338-8296360 GCACTGCTCCGCCCCCACGGCGG - Intergenic
1064028682 10:11869623-11869645 GCGCGCCCCCTCCCCGCCGGTGG + Exonic
1064060024 10:12129592-12129614 GCCCAGCCCCGCCCCCAGGGCGG - Intergenic
1064230781 10:13528442-13528464 GCCTGCCCCCGCCGCCCCGGCGG + Intronic
1065687804 10:28303075-28303097 CCGCGGTCCCGCCCCTCCGAGGG - Intronic
1066370637 10:34815525-34815547 GAGGGGTCCCGCGCCCCCGGAGG - Intergenic
1067118669 10:43455739-43455761 CCGCGGCCCCGCCCTCCGGCGGG - Intronic
1067937595 10:50624580-50624602 GAGCCGCCCCGCCCCGCCTGGGG + Intronic
1069438557 10:68407352-68407374 GCGGGTCCCCGCCCCGCCCGGGG - Intergenic
1070126453 10:73625902-73625924 CCCCGGCCCCGCCCCCCTGAGGG + Intronic
1070623711 10:78033785-78033807 GCGCGCCCACGCCCCCACGCCGG + Exonic
1070800469 10:79242277-79242299 GCGCGGCCCTGCCCCGCCCCGGG - Intronic
1071309370 10:84328539-84328561 GCGCAGTCCCGCCCCGCCGCGGG - Intergenic
1071618196 10:87095023-87095045 GCGCGCCCCCGACGCCCCGCCGG - Intronic
1072151747 10:92689872-92689894 GCGCGGCCCCACCCCGCGGCCGG + Intergenic
1073071792 10:100798875-100798897 GCCCAGCCCCACCCCCACGGCGG - Intronic
1073106008 10:101032333-101032355 TCCCGGCCGCGCCCACCCGGTGG - Exonic
1073122535 10:101131506-101131528 CCGCCGCCCGGGCCCCCCGGTGG + Exonic
1074056057 10:109923586-109923608 CCGCGGCCCCGCCCACACGCAGG + Intergenic
1074618410 10:115093238-115093260 GCCCCGCCTCGCCCGCCCGGCGG - Intergenic
1074618453 10:115093377-115093399 GCGCGGCCCCGCCTCGCCCGCGG - Intronic
1075999842 10:126905727-126905749 CGGCCGCCCCGCGCCCCCGGCGG + Intronic
1076116962 10:127907443-127907465 CCCCGGCCCCGCCGCCCCCGCGG + Intronic
1076784345 10:132742298-132742320 GCGCAGCCCCGCCCTGCAGGAGG + Intronic
1076853294 10:133103474-133103496 GCCCTCCCCCGCCGCCCCGGCGG + Intronic
1077043523 11:534868-534890 GCAGCGCCCCGCACCCCCGGCGG + Intronic
1077101260 11:823635-823657 GCGCGGCCGCGGCCCGCAGGGGG - Intronic
1077121509 11:910955-910977 GCGCGGCCCCGCCCCGGCCCCGG - Intronic
1077247728 11:1547492-1547514 TGGCGGCCCCGCCCTCCCTGAGG - Intergenic
1077250063 11:1557011-1557033 CGGCGGCCCCGGCCCCCCGCCGG - Exonic
1077320006 11:1936864-1936886 GCGCAGCCCAGCCCACCCTGCGG + Intronic
1077358108 11:2127915-2127937 GAGCAGCCCCGACCCCCTGGGGG + Intergenic
1081808486 11:45902530-45902552 GAGTGGCCCCGACCCCCAGGCGG - Exonic
1083207415 11:61161155-61161177 GCGCCGCCCCGGCTCCCCGGCGG - Intronic
1083335118 11:61917599-61917621 GCCCGGCCCCGCCCCTCCGCCGG + Intronic
1083667712 11:64284790-64284812 GCCCGGCCCCGCCCCCCCGCCGG + Intronic
1084207941 11:67606827-67606849 CAGCGGCCCCGCCTCCTCGGGGG - Intergenic
1084431885 11:69115819-69115841 GAGCGGCCCCGCCCTCCCCCAGG - Intergenic
1084516983 11:69642673-69642695 CCGCGGCCCCGCACCCCAGTTGG + Intronic
1085176646 11:74493723-74493745 GCGGGGCCCCGCCCTCTCCGTGG + Exonic
1085396871 11:76210834-76210856 GCGCGGCCGGGGCCACCCGGTGG - Intergenic
1085485638 11:76860854-76860876 GCCCGGCCCTGCCTCCCCGAGGG - Exonic
1085507100 11:77066894-77066916 GCTCCGCCCCGCCCCGCCCGCGG - Intergenic
1087076213 11:94129092-94129114 GCCCCGCCCCGCCCCGCCGGCGG + Exonic
1087113200 11:94493942-94493964 GCGAGGCCCCGCCCTCACGCAGG + Exonic
1091616111 12:2052654-2052676 GCGCGCCCCGGCCTCCCCGGGGG + Intronic
1091684313 12:2550687-2550709 GCCCTGCCCCGCCCCCCAGGTGG - Intronic
1091747770 12:3003637-3003659 CCACGGCCCCACCCCACCGGGGG - Intronic
1094840608 12:34341268-34341290 GCGGGGCCCAGCCGCTCCGGGGG - Intergenic
1096627255 12:52903571-52903593 GAGGGGCCCCGGGCCCCCGGCGG - Intronic
1097057451 12:56258378-56258400 GCGCGGCCCCGCCTACCGGGGGG + Exonic
1097925433 12:65121608-65121630 TCGCGGCCCCGCCCCCGGGGGGG - Intergenic
1098105845 12:67068929-67068951 GCGCGGCGCCCCTCCCCCGTCGG + Intergenic
1098161311 12:67649546-67649568 GCGCGGCCCGGCTCCCCCGCCGG + Intronic
1098425946 12:70366177-70366199 GCTCCGCCCCGCCCCGCCCGGGG - Intergenic
1100309037 12:93377762-93377784 GCGCGGCCCCGCCCACCGGGCGG + Intergenic
1101504060 12:105330653-105330675 CCCCGGCCCCGCCCCGCCCGGGG - Exonic
1101640129 12:106581629-106581651 GCGCTTCCCCGCCCCCGCCGCGG + Intronic
1101772093 12:107761043-107761065 GCTCGGCCCCCTCACCCCGGGGG + Exonic
1103400610 12:120640786-120640808 GCGCGGCGCGGGGCCCCCGGCGG - Exonic
1104093279 12:125533662-125533684 GCGCGCCCTCCCCTCCCCGGCGG + Intronic
1105578441 13:21673739-21673761 GCGCGGCCCCGACACCCTGCGGG - Intronic
1106157571 13:27172009-27172031 GCGCAGCCCCGCCCACCCCTCGG + Intergenic
1112271949 13:97976613-97976635 GCCCGCCCCCGCCCCTCCCGCGG + Intronic
1112319706 13:98395315-98395337 GTGCGACCCCGGCTCCCCGGCGG - Exonic
1112365613 13:98752735-98752757 CCGCAGCACCGCCCCCCGGGTGG - Intergenic
1113379209 13:109787003-109787025 GCCCGGCGCCCCCTCCCCGGCGG - Intergenic
1113656836 13:112072818-112072840 GCCCGGCCACCCCCGCCCGGAGG - Intergenic
1113923580 13:113928320-113928342 GCGCAGCCCCGCCCCTCCTGGGG - Intergenic
1114483201 14:23047938-23047960 CCGCTGCCCCCCCCCCGCGGTGG + Exonic
1114558876 14:23577465-23577487 GCGCGGCCTCAGCCCCCCGGCGG + Exonic
1115650979 14:35403111-35403133 GCCCTGCCCCACCCCCTCGGAGG - Intronic
1115819403 14:37197946-37197968 GCGCCGCCCCGCTCCTCCGCCGG + Exonic
1115850086 14:37584056-37584078 GCCCGGCCGGGCCCCTCCGGCGG + Intergenic
1116862173 14:50003470-50003492 GGGCGTCCCCGCGCCCCCGGGGG - Intronic
1118220975 14:63853775-63853797 GCGCCCCCCCGCCCCCGCGGAGG - Intronic
1118285263 14:64465376-64465398 GCGCCGCCCCGCGCCTCCGGCGG + Intronic
1118514164 14:66508345-66508367 GCGCGGCCTCTCCCCCACGCAGG + Exonic
1118887518 14:69879361-69879383 GCTCCGCCCCGCCCCTCCCGGGG + Intronic
1119318428 14:73714431-73714453 GCCCCGTCCCGCCCCCGCGGCGG + Intergenic
1122220885 14:100238702-100238724 CCGCGGCCCCGCCCACTCGCCGG - Intronic
1122917482 14:104865660-104865682 GCGGGTCCCCGCCGCCGCGGAGG + Intronic
1123025066 14:105420323-105420345 GCGCCCCCCCGCCACCCCCGCGG - Intronic
1123052166 14:105549789-105549811 ACGCGGCCCCGCCGCCCCCCAGG + Intergenic
1123630519 15:22257500-22257522 CCGCGGCCACGCCGCCCTGGGGG - Intergenic
1124581089 15:30955643-30955665 GTGCTGCCCCGCCCCCCCCTTGG - Intronic
1124652451 15:31483836-31483858 GGGCGGCACGGCCTCCCCGGGGG - Exonic
1125535897 15:40441122-40441144 GCCCGGCCCCGGCCCCCAGGAGG + Intronic
1125577176 15:40763945-40763967 GCCCGCCCCCGCCCTCCCGGCGG - Intergenic
1125999374 15:44194921-44194943 GCGCCGCCCCGCCCCGCCCGCGG - Intronic
1128145983 15:65332784-65332806 GCAGGGCCCCGCCCCACGGGAGG + Intronic
1128841344 15:70853835-70853857 GCGCGGCCCGGCGCCCCCTCGGG + Intronic
1129468743 15:75738633-75738655 GAGCGGCCCCGCCCACCCTAAGG + Intergenic
1129725706 15:77900496-77900518 GCCCCGCCCCACCCCCCTGGAGG - Intergenic
1130040932 15:80404628-80404650 CTGCGGCTCCGCGCCCCCGGGGG - Intronic
1131215093 15:90529861-90529883 GCCCGGCCCCGCCCCACCCTCGG - Intergenic
1132475940 16:138269-138291 CCCCGGCCCCGGCCCCACGGCGG - Exonic
1132480581 16:164723-164745 CCGCGGCCCCGCCCGCCCCGCGG - Intronic
1132806602 16:1777913-1777935 GCTCGGCCCCGCCCCACCCTGGG + Intronic
1133058345 16:3158604-3158626 CCGCGGCGCCGCCTCCCCGAGGG - Intergenic
1133259225 16:4537900-4537922 GCTCGGCCGCGCATCCCCGGCGG - Intronic
1133304852 16:4802478-4802500 GCCCGGCCCCGCCGCCCCGCCGG + Intronic
1133464859 16:6019505-6019527 GAGCGCCCCCGCCCCACCGCGGG - Intronic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1134584048 16:15395926-15395948 GCGCGGCCCGGCGCCACCCGTGG + Exonic
1134614890 16:15643263-15643285 GCGAGGCCCCGCCCCCCCCGGGG - Exonic
1135040474 16:19114024-19114046 GCGCGGCCTCGCCTCCCCCTCGG + Exonic
1135597418 16:23754969-23754991 GGGCGGCCACGCCTCTCCGGCGG + Exonic
1135712537 16:24729867-24729889 CCGCGGCTCCTCCCGCCCGGAGG - Intronic
1136390602 16:29962007-29962029 GCGCGGCCCCGCCCCGCGGCCGG - Intronic
1137617605 16:49856656-49856678 GCCCGGCGCCGGCCCCCCGGAGG + Intronic
1137787997 16:51152651-51152673 GCGCGGCCCCCTCCCCAGGGCGG - Intergenic
1139484607 16:67248671-67248693 GCGCGGCCACGGCCCCCCTGGGG - Intronic
1141054778 16:80804622-80804644 GCCCGGCCCGGCCCCCGGGGCGG + Intergenic
1141490363 16:84368462-84368484 GCGCAGCCCCGCCCCAGGGGCGG + Intergenic
1141608785 16:85169998-85170020 CCGCGGCCCCGCGCAGCCGGGGG - Intergenic
1141645662 16:85366112-85366134 GCGCAGTCCCGCCTTCCCGGCGG - Intergenic
1141709418 16:85689173-85689195 CCCCGGCCCCGCCCCGCCCGTGG + Intronic
1141972571 16:87493149-87493171 CCGCGGCCACGCCTCCCTGGGGG + Intergenic
1142006145 16:87690400-87690422 GCTCGGCCCCGCCCAGCCGCAGG - Exonic
1142393322 16:89816543-89816565 GCTCGGCCCAGGCCCTCCGGCGG + Exonic
1142403775 16:89874365-89874387 CCGTGGCCCCACCCCCACGGTGG - Intronic
1142413086 16:89926040-89926062 GCCCGCCCCTGCCCCCCCCGGGG - Intronic
1142611088 17:1109472-1109494 CCGCGGCCCCGCAACCCCAGAGG - Intronic
1142627767 17:1203363-1203385 TCAAGGCCCCGCCCCCACGGGGG - Intronic
1142709706 17:1716318-1716340 ACGTGGCCCCGCCCACCCGGGGG + Intergenic
1142849305 17:2696578-2696600 GCGCAGCCCAGCTCCACCGGTGG - Intronic
1142863402 17:2776806-2776828 GAGGGACCCCGCCGCCCCGGAGG + Intergenic
1143174349 17:4947941-4947963 GCGCGTCCCCGCCCCGCCCTGGG + Intronic
1143633673 17:8152403-8152425 CCGCCTCCCCGCCCGCCCGGTGG - Exonic
1144905658 17:18638371-18638393 GCCCGGCCCCGCACCGCCAGGGG + Exonic
1145776018 17:27529502-27529524 GAGCGGCATCGCCCCCCTGGAGG - Intronic
1145863782 17:28227543-28227565 CTGCGGCCCCGCTCCACCGGGGG + Intergenic
1146654452 17:34626803-34626825 CCCCGGGCCCGGCCCCCCGGCGG - Intronic
1147440386 17:40443841-40443863 GCGCGCTGCCGCCCCCCCGTGGG + Exonic
1148048679 17:44758989-44759011 ACCCGGCCCCGCCGCCCCGCCGG + Intergenic
1148203101 17:45762948-45762970 GGGCGGCCCCTCCCCCCGGGGGG - Intergenic
1148830174 17:50426114-50426136 GCCCCGCCCCGCCCCGCCGGCGG + Intergenic
1150326671 17:64263292-64263314 ACGCCGCCCCGCCCCGCCGGCGG + Intronic
1151801971 17:76384216-76384238 GCGCGGCTCCGCTCTCCCGGGGG - Intronic
1151802064 17:76384567-76384589 GCTCCGCCCCGCGCTCCCGGGGG - Intronic
1151866427 17:76806250-76806272 CCCCGGCCCCGCCGCCCCGCCGG + Intergenic
1152613756 17:81328687-81328709 GCGAGGCCCCGCCCCCACCCTGG - Intronic
1152617864 17:81346096-81346118 CCGCCGCCCCGCCCCCACGAGGG + Intergenic
1152639045 17:81442141-81442163 GGGCGGCCCCGCACCCCGAGGGG + Exonic
1152728747 17:81959974-81959996 GCGCCGCCGCGCGCCCCGGGAGG - Intronic
1152729183 17:81961424-81961446 GCGCGGCCGGGCGGCCCCGGCGG + Intronic
1152729196 17:81961470-81961492 GCGCCGCCGCCCCCCCCCGCGGG + Intronic
1153935139 18:9914354-9914376 GCGCGCCCCACCCCACCCGGGGG - Intronic
1156036614 18:32772110-32772132 CCGCCGGCCCGCCCGCCCGGGGG + Exonic
1158602009 18:58863762-58863784 CCGCCGCCCCGCACCCCCAGAGG - Intronic
1160019616 18:75170297-75170319 GCAGGGCCCCGCCCCTCCGAAGG - Intergenic
1160518229 18:79490092-79490114 CCCCGCCCCCGCCCCCCCGTGGG + Intronic
1160719355 19:590584-590606 GCGCCGACCGGCCCTCCCGGAGG - Intronic
1160791717 19:926445-926467 GCGCGCCCCCCCCTCCCCAGCGG + Intronic
1160943376 19:1630248-1630270 GCCTGGCCCCGCCCCCCTGCCGG - Intronic
1160947967 19:1652271-1652293 GCGCGCCCCCCGCCCCCCGCCGG + Intronic
1160957088 19:1698772-1698794 CCGCGCTTCCGCCCCCCCGGCGG - Intergenic
1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG + Intergenic
1161170679 19:2810965-2810987 GTGCGGCCCCAGCCCCCAGGAGG + Intronic
1161510944 19:4670528-4670550 CGGCGGCCCCGCCCCCTCGGCGG - Intergenic
1161681268 19:5681000-5681022 GCCCGGCCCCGCCCACTGGGCGG - Intronic
1161801028 19:6416824-6416846 CCTCGGCCTCGGCCCCCCGGGGG + Exonic
1161925039 19:7293855-7293877 GCGCGGCCGCCGCCCCCCGCCGG + Exonic
1162019565 19:7862545-7862567 CCGCGGCCCCGCCCTGCCCGTGG + Intronic
1162238094 19:9324116-9324138 CCGAGGCCCCGCCCCCTAGGTGG + Exonic
1162339868 19:10086065-10086087 ATGCGGCCCCGCCCCCACGAGGG + Intergenic
1162940391 19:14005897-14005919 CCGCGGCCCGGCCCCCGCGAGGG - Intronic
1163012155 19:14433223-14433245 GCGGGACCCCGCAGCCCCGGGGG + Intronic
1163118366 19:15201059-15201081 GCGCGCCCCCGCCCCCCGCCCGG + Intergenic
1163248424 19:16111543-16111565 GCCCGGCCCCGCCCCACTGTAGG - Intergenic
1163442250 19:17328122-17328144 GCGAGGCCCCGCCCCCTGCGAGG + Intronic
1163573527 19:18097672-18097694 GCCTGGCCCCGCCCCTCCCGGGG - Intronic
1165213587 19:34254318-34254340 GCCCGACCCCTCCCGCCCGGGGG + Intergenic
1165431368 19:35775411-35775433 CCGATGCCCCGCCCACCCGGAGG - Intronic
1166090325 19:40504136-40504158 CCGCATCCCCGCCCCCCCGCCGG - Intronic
1166105969 19:40598212-40598234 TCCCGGCCCCGCCCCCGCCGCGG - Intronic
1166584697 19:43935339-43935361 CCGCTGCCCCGCCCCCTGGGCGG + Intergenic
1166824774 19:45601998-45602020 GCTCCTCCCCGCCCCCTCGGGGG - Intronic
1167071715 19:47226091-47226113 TCGCAGCCCCGCCCCGCGGGAGG - Intronic
1168240614 19:55087118-55087140 ATGCGGCCACGCCCCCCGGGTGG + Intronic
1202714324 1_KI270714v1_random:33860-33882 GCGCGGACCCGCGCCCACGACGG - Intergenic
925384188 2:3450541-3450563 GCGCCCCCTCGCCACCCCGGGGG - Intronic
926101348 2:10120347-10120369 GCCCCGCCCCGCCCCCCGGAAGG - Intergenic
927905043 2:26849404-26849426 GCGGGGCCCCGCGGCCCAGGTGG + Intronic
930011454 2:46941153-46941175 CCGCGGCTCCACCCCCGCGGGGG - Exonic
931602665 2:64019440-64019462 CCGCGGCCCTCCCGCCCCGGCGG - Intergenic
934954733 2:98608281-98608303 GCGCGGCCGGGCGCTCCCGGTGG - Intronic
935622842 2:105144147-105144169 GCTGGGCCCCGCGCGCCCGGCGG - Intergenic
937153746 2:119703631-119703653 GCCCTGCCCCGCACCCCAGGAGG + Intergenic
937261222 2:120587679-120587701 GCGCGGCCCGGCCCGCGGGGCGG - Intergenic
938058414 2:128233633-128233655 GCGCCACCCCGCCCGACCGGAGG - Intergenic
941021041 2:160407970-160407992 GCGCCTCCCCGCCCGCCCGCTGG + Intronic
942678222 2:178450812-178450834 GCTCGGCCCCGCCCTCTCGGCGG - Intronic
942944414 2:181657135-181657157 GCGCGGCCCCGCCTCCCTCCTGG - Intronic
942947324 2:181684305-181684327 ACGCGGCGCCTCCGCCCCGGGGG + Intergenic
944271279 2:197786690-197786712 GCGCGGCCCCGCCCGCCTGGCGG - Intronic
945225713 2:207529845-207529867 GAGCGGCCCCGCCCCCGCGCTGG - Intronic
946235670 2:218323193-218323215 GCCCGGCCCCGGCCCCCCGCGGG - Intronic
946362834 2:219229404-219229426 GCGCGCCCCCGCCCCGCCGGCGG + Intronic
947549813 2:231037967-231037989 GCGCCGCCCCGGCCCGCCGCCGG - Exonic
948046968 2:234952219-234952241 GCACGACCCCGCGCCCCCGCCGG - Intronic
948449573 2:238060874-238060896 GCGCAGCCTCGCCTCCCCGCTGG + Exonic
948473814 2:238203721-238203743 GCGTGGCCCGGCCGCCCCAGAGG + Exonic
948738321 2:240025422-240025444 GCGCGGCCCCGCCCCCTGGAAGG - Intergenic
948824211 2:240566557-240566579 GCCCCGCCCCGCCCCGCCCGAGG - Intronic
1168757314 20:326288-326310 GCGCGGCCCCGCCCCCCCGGTGG + Exonic
1168951281 20:1803608-1803630 GCGGCGCCCCGCTCCCCAGGTGG - Intergenic
1169278479 20:4248840-4248862 GGGCGGCGCGGCCCCCTCGGAGG - Exonic
1170204691 20:13785296-13785318 CCGCCGCCCCGCCGCCCCGCGGG - Intronic
1170460870 20:16575113-16575135 GCGCGCCGACGCCCCCCAGGTGG - Intergenic
1170562598 20:17569983-17570005 GCCAGGCAACGCCCCCCCGGCGG - Exonic
1170578613 20:17681960-17681982 GGCCGGCCCCGGCCCCCCGACGG + Intronic
1172101217 20:32484582-32484604 GCCCGCCCCCGCCCCGCCGCCGG + Intronic
1172295985 20:33811519-33811541 GGGCGGCCCGACCCCCCAGGAGG + Exonic
1172662116 20:36574666-36574688 GCGCGGGCCCGCCATCCCGGTGG - Intronic
1172684833 20:36745866-36745888 GCCCCGCCCCGCCCGCCCGCCGG - Intronic
1173736181 20:45363262-45363284 GCGTGGCCCGGCCTCACCGGCGG - Exonic
1174804259 20:53593175-53593197 GCGAGGCCCAGCCCCTCCCGCGG + Intronic
1175108115 20:56628739-56628761 GCGCGGTCCCGGCCCCCGGGCGG - Intergenic
1175562152 20:59939783-59939805 GCGCGGCCCGGGCTCCCAGGGGG + Exonic
1175856204 20:62122306-62122328 GCGAGGGCCCGCCCCCCAGCTGG + Intergenic
1176048019 20:63102708-63102730 GCGGGCCACCGCCCACCCGGGGG - Intergenic
1176550190 21:8217421-8217443 GCGCGGAACCGCGGCCCCGGGGG - Intergenic
1176569118 21:8400459-8400481 GCGCGGAACCGCGGCCCCGGGGG - Intergenic
1176577032 21:8444691-8444713 GCGCGGAACCGCGGCCCCGGGGG - Intergenic
1178708196 21:34890784-34890806 GCGCGCGCCCGCCCGCCCGCAGG + Intronic
1179921700 21:44510871-44510893 CCCCGGCCCCGCCCCCGCCGAGG - Intronic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1180560186 22:16609600-16609622 GTGAGGCCCAGCCCCTCCGGCGG + Intergenic
1180717882 22:17884281-17884303 GCCCTGCCCCCACCCCCCGGTGG - Intronic
1180949504 22:19714798-19714820 GCGCAGCGCCGCTCCCCCGCCGG + Intronic
1180960586 22:19760688-19760710 GCCCCGCCCCGCCCCGCCCGGGG - Intronic
1181017678 22:20080483-20080505 CCGCGCCCCCGCCCCGCCCGCGG - Intronic
1181457917 22:23070251-23070273 GCGCGGCACCCCCCCGCCCGCGG + Intronic
1181670619 22:24424056-24424078 TCCCGGCCCCGCACCCCCGACGG - Intronic
1181956359 22:26590135-26590157 CCGCGGCCCCGCCCCCGCGCGGG - Exonic
1183149940 22:36029028-36029050 GCCTGGCCCCGCCCCCCCCGCGG - Intergenic
1183299459 22:37051791-37051813 GCGCGGCCGCCCGCCCCCGCCGG - Exonic
1183444448 22:37843939-37843961 GCGCTGCCAGGCCCCACCGGCGG - Exonic
1183525002 22:38317495-38317517 GCCCGCCGCCGCCGCCCCGGAGG + Intronic
1184101465 22:42343645-42343667 GCGCGCCCCGGCCGGCCCGGGGG + Intergenic
1184562054 22:45269129-45269151 GCGCGGCACCGCCCCCTCCCCGG + Intergenic
1184759760 22:46537659-46537681 GCCCGGCCCCGCCCCGCCCCCGG + Intergenic
1185302486 22:50089833-50089855 TCGAAGCCCCGCCCACCCGGCGG + Intergenic
1185395218 22:50583192-50583214 CCGCCGCCCCGCCGCCCCGCCGG - Intronic
1203255085 22_KI270733v1_random:133759-133781 GCGCGGAACCGCGGCCCCGGGGG - Intergenic
1203263141 22_KI270733v1_random:178838-178860 GCGCGGAACCGCGGCCCCGGGGG - Intergenic
950610662 3:14124782-14124804 GCGCGGACCCGCCCCCTCCCAGG + Exonic
953326205 3:42014012-42014034 GCCCGGCCCCGGCCGCCCGGCGG - Intronic
954028680 3:47803014-47803036 GCACGGCTCCGCTCCCCCGCGGG - Exonic
954293595 3:49662379-49662401 GGGAGGCCCCGCCCTGCCGGAGG + Exonic
954763880 3:52897224-52897246 CCGCGGCCCGGCCCCCCTGGGGG - Intronic
958718955 3:97821956-97821978 GCGCGGCCCGCCCCACCCCGAGG - Intergenic
961345142 3:126259452-126259474 GCCAGGCCGCGCCCTCCCGGGGG - Intergenic
961603034 3:128075675-128075697 GCGCTGCCCCTCCCCCCATGGGG - Intronic
966594321 3:181712327-181712349 GCGCGGGCCCGGCCCGCCGGCGG - Exonic
967055350 3:185825117-185825139 GGCCGGCCCGGCCCGCCCGGGGG + Intergenic
967859743 3:194141717-194141739 GCGCGGCCCCGCCGGGCCTGGGG + Intergenic
968513335 4:1004747-1004769 GCTCGGCCCTGCCCACCCAGGGG + Intergenic
968534096 4:1113004-1113026 CCGCGGCCCCCACTCCCCGGTGG + Intronic
968804605 4:2764063-2764085 GCGGGGCCGCGCCCACCCGGAGG - Intergenic
969239152 4:5888087-5888109 GACCGGCCCCGCCCCACCCGCGG + Intronic
969288291 4:6222048-6222070 GAGCGGCCCGGCCCCTCTGGTGG + Intergenic
969468267 4:7370643-7370665 GCGCGGCCCCTGCCTGCCGGTGG + Intronic
969713712 4:8858622-8858644 GCGAGGCCCCGGCCGCCCGGGGG - Intronic
970394855 4:15655421-15655443 GCGCGCCCCCGCGTCCCCGCCGG - Intronic
971231019 4:24800245-24800267 GCGCGGCCCCCACCCGGCGGCGG + Exonic
972437038 4:39044753-39044775 GCCAGGCCCCGCCCCCTCGCCGG - Intergenic
974186828 4:58457231-58457253 GCGCAGCCCAGCCTCCCCGATGG + Intergenic
980930034 4:139176636-139176658 GCTCGGCCCATCCCCCCCGCCGG + Intronic
983923471 4:173371346-173371368 GCCCGGCCCGGCCGCCCCCGGGG - Exonic
984668020 4:182448902-182448924 GCGGCGCACCGCCCCCTCGGCGG + Intronic
985064304 4:186105472-186105494 GCGCGGCCCAGACCCCGCCGGGG - Intronic
985253050 4:188042382-188042404 GTGCGGCTCCGACCCCACGGCGG - Intergenic
985537396 5:472939-472961 GCGCGGACCCTTCCCGCCGGCGG + Exonic
995402509 5:111758038-111758060 GCGCGGCTCCGCGCCGCCGCAGG - Intronic
996551505 5:124735372-124735394 GCACGCCCCCGCCGCCCCGTCGG + Intronic
996978537 5:129461622-129461644 TCCCGGCCCCGGCCCCACGGGGG + Exonic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
998166675 5:139848292-139848314 GCGCGCCCCCGCCGCCGCCGCGG - Exonic
998266974 5:140673645-140673667 GCGCGACCCCGCCTCCCAGGGGG + Exonic
1002064905 5:176647207-176647229 GCCAGGCCCCGCCCCCGCGCAGG - Intergenic
1002559576 5:180072136-180072158 CCGCCGCCCCGCCCCCCCGCTGG + Intergenic
1002638943 5:180621509-180621531 GCGCGTCCCCGCCCTCCCCGCGG + Intronic
1002813410 6:656602-656624 GCGCCGCCCCTCCCTCACGGTGG - Exonic
1002926822 6:1609840-1609862 GCGGAGCCCCGCCCCGCCAGCGG - Intergenic
1003942589 6:11044076-11044098 GCGCGGACCCGGCCCCTCCGAGG + Intronic
1004140570 6:13013860-13013882 GCCCGGCCCCGGGCGCCCGGGGG + Intronic
1006337474 6:33428076-33428098 GCGGGGCCCCTCCCCCACCGGGG + Intronic
1006458293 6:34144269-34144291 TCCCGGCCCCGCCCCCGCGCGGG + Intronic
1006472703 6:34237456-34237478 GCGCGGCCCTCCCCCGCCGCCGG - Intronic
1006589193 6:35141612-35141634 GCGCGGCCCCTGCGCCCCTGCGG - Exonic
1007656765 6:43455394-43455416 GCGCGCCACCTCCCCGCCGGAGG - Intronic
1007784275 6:44271015-44271037 GCGCCGCCGCCCCCACCCGGCGG + Intronic
1013538826 6:111087809-111087831 GCTCGGCCCCGCGCCCACGGGGG + Exonic
1015517395 6:134096929-134096951 CCGCTGCCCCGCCACCCGGGTGG - Intergenic
1016738772 6:147507803-147507825 GCCCGGCCCCTCCCCCTCGTCGG - Intergenic
1017164180 6:151391659-151391681 TCGCCGCCTCTCCCCCCCGGCGG - Intergenic
1017672351 6:156779072-156779094 TCGCGGCCCCGCCGCCCCCGGGG - Exonic
1017672498 6:156779568-156779590 CCGCGCCCCCGCCGCCCCCGCGG - Intronic
1017971511 6:159315861-159315883 GCGCAGCCCCGGCCTCCCCGTGG - Intergenic
1018013590 6:159693323-159693345 GCCCCGCCCCCCCCCCCCGCGGG + Exonic
1019331702 7:463602-463624 CCGCGGCCCCGGCCCCACTGCGG + Intergenic
1020224973 7:6272640-6272662 GCGAGGCCCCGCCCGGCGGGAGG - Exonic
1021998334 7:26201627-26201649 GCGCGGCCCCTCCCCCCGCCGGG + Intronic
1022101669 7:27173001-27173023 GCGCGGCGCGGCCCACGCGGGGG - Intronic
1024323151 7:48089202-48089224 GAGCGGCCCCGCCCTGCCCGGGG - Exonic
1026968425 7:74454255-74454277 GCGGGGACCCCCCCCCCCGGAGG - Intronic
1027001770 7:74658612-74658634 GCGCGGCCCCGCCCCCGCGCCGG - Intronic
1029270848 7:99375515-99375537 GCCCGGCCCCGCCCCGCCCTAGG - Intronic
1029273855 7:99392895-99392917 CCGAGGCCCCGCCCACCCGCCGG - Intronic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1033159217 7:138981632-138981654 GCGCGGCCCAGCCCTCCCCCAGG + Intergenic
1033683667 7:143620527-143620549 GAGCGACCCCGCCTTCCCGGAGG - Intergenic
1033700945 7:143837111-143837133 GAGCGACCCCGCCTTCCCGGAGG + Intergenic
1034159650 7:148983368-148983390 GCCCGGCCCCACCCCCGCGGCGG + Intergenic
1034426555 7:151017062-151017084 TCGCGGCCCCTCCACCCCGGGGG - Exonic
1034455601 7:151168098-151168120 GCTCGGCCCCGCCGCCCCATCGG - Intronic
1034898454 7:154892558-154892580 GCCCCGCCCCGCCCCTCCGAGGG - Exonic
1035212358 7:157337410-157337432 ACGCGGCCCAGCCTCCGCGGCGG + Intronic
1037819910 8:22130582-22130604 GAGCGCCCCCGCCGCCCCGGGGG - Exonic
1037826800 8:22164858-22164880 GCTCGGCCGCGCGCCCGCGGGGG + Exonic
1038540171 8:28385392-28385414 GTGCAGCCCCGCCCCCCCCCCGG + Intronic
1038789716 8:30657887-30657909 GCGCGCCGCCGCCTCCCGGGAGG - Intronic
1039560974 8:38512323-38512345 GCCCGGCCCCTCCCTCGCGGAGG - Exonic
1039886006 8:41654172-41654194 TCCCGGCCCCGCCCTCGCGGCGG - Intronic
1040543585 8:48380378-48380400 GCAAGGCCCCGCAGCCCCGGGGG - Intergenic
1040804381 8:51377816-51377838 GCGCAGCCCCAGCCTCCCGGAGG + Intronic
1041693628 8:60714175-60714197 GGGATGCCCCGCCCCCCGGGGGG - Intronic
1042040211 8:64581376-64581398 CCGCCGCCCAGGCCCCCCGGGGG - Exonic
1042267687 8:66925599-66925621 ACGCGGCCCCGCCCCTCCGCGGG + Intergenic
1043284868 8:78516252-78516274 GAGCGGCCCCGCTCCCCCCGTGG + Exonic
1047615431 8:126558568-126558590 GCCCGGCCACGCCCCCGCGCCGG + Intergenic
1048424577 8:134311555-134311577 GCGGGACCCAGCCCCCCTGGAGG + Intergenic
1049396347 8:142402945-142402967 GCGCGGCCCCGCCCCCCGCCCGG + Intronic
1049441684 8:142612546-142612568 GCGCGGCCCCCTCCTCCCAGGGG - Exonic
1049665536 8:143841100-143841122 CCCAGGCCCCGCCCCCCCGGAGG + Intergenic
1049684000 8:143932058-143932080 GCCCCGCCCCGCCCCGCCTGGGG + Intronic
1049693711 8:143973606-143973628 CCCCGGCCCCGCCCCGCCCGTGG - Intronic
1049762199 8:144336653-144336675 GCCCGGCGCCGCCGCCCCCGGGG - Intergenic
1049867885 8:144950656-144950678 GCGCGGCTCCGCCCCCGCCCGGG + Intronic
1051235373 9:14993375-14993397 CTGCGGCCCCGCCCCCGCGCCGG - Intergenic
1053273487 9:36766195-36766217 CCGAGGCACCGCCCCCGCGGAGG + Intergenic
1053569431 9:39288487-39288509 CCGCGGCCGCCCCGCCCCGGTGG - Intergenic
1053835392 9:42129508-42129530 CCGCGGCCGCCCCGCCCCGGTGG - Intronic
1054127715 9:61330523-61330545 CCGCGGCCGCCCCGCCCCGGTGG + Intergenic
1054595234 9:67059102-67059124 CCGCGGCCGCCCCGCCCCGGTGG + Intergenic
1055321598 9:75088209-75088231 GCCCCGCCCCGCCCCAACGGGGG - Exonic
1056991970 9:91421379-91421401 CCGCTGCGCCGCCCACCCGGAGG - Intronic
1057432319 9:95005234-95005256 GCGCGGTCCCTGCGCCCCGGTGG + Intronic
1059440073 9:114301700-114301722 GGGCGGCCCGGCCCCCCGGTAGG + Exonic
1060106779 9:120877437-120877459 GCCCGCCCCCGCCCGCCCCGCGG + Intronic
1060478079 9:124000060-124000082 GCTCGGCCCGGCCCGCCCGAGGG + Intergenic
1061151283 9:128829654-128829676 GCGCGGCCCGGCCCCGGCGAAGG + Intronic
1061540634 9:131276559-131276581 GCGCGGCCGCGCCACCCTCGCGG + Intergenic
1061802817 9:133121358-133121380 CCGCGGCCCCGCCCTCGCCGAGG + Intronic
1062172041 9:135140259-135140281 GCGTGTCCCCGCCTCCCTGGTGG + Intergenic
1062341417 9:136095316-136095338 CCGCCGCCCCGCCCCCGCCGCGG - Intergenic
1062659122 9:137619145-137619167 CCGGGGCCCCGCCCGCCCGCCGG - Intronic
1203471483 Un_GL000220v1:116896-116918 GCGCGGAACCGCGGCCCCGGGGG - Intergenic
1203479304 Un_GL000220v1:160868-160890 GCGCGGAACCGCGGCCCCGGGGG - Intergenic
1186485590 X:9932296-9932318 GCTCGGCCCCGGCCCTCCCGGGG - Exonic
1189331250 X:40146221-40146243 GCGGGGCTCCGCTCCCGCGGAGG + Intronic
1196918262 X:120561165-120561187 GAGCTCCCCCGCCCCCCGGGCGG - Intronic
1200003298 X:153072781-153072803 GTCCCGCCCCGCCCCCCCGGGGG - Intronic
1200004425 X:153077228-153077250 GTCCCGCCCCGCCCCCCCGGGGG + Intergenic
1200128889 X:153830589-153830611 GCGCGCCCCCGCGCTCCCTGGGG - Intergenic