ID: 1168757368

View in Genome Browser
Species Human (GRCh38)
Location 20:326455-326477
Sequence CCCGCCCCGGGGTCTCGACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 105}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168757368_1168757375 -8 Left 1168757368 20:326455-326477 CCTGGTCGAGACCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1168757375 20:326470-326492 GGGGCGGGAGCTGTGGAGGATGG 0: 1
1: 0
2: 8
3: 92
4: 949
1168757368_1168757379 6 Left 1168757368 20:326455-326477 CCTGGTCGAGACCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1168757379 20:326484-326506 GGAGGATGGTCCCGGCGGGACGG 0: 1
1: 0
2: 2
3: 14
4: 206
1168757368_1168757380 7 Left 1168757368 20:326455-326477 CCTGGTCGAGACCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1168757380 20:326485-326507 GAGGATGGTCCCGGCGGGACGGG 0: 1
1: 0
2: 0
3: 8
4: 123
1168757368_1168757378 2 Left 1168757368 20:326455-326477 CCTGGTCGAGACCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1168757378 20:326480-326502 CTGTGGAGGATGGTCCCGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 115
1168757368_1168757376 -2 Left 1168757368 20:326455-326477 CCTGGTCGAGACCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1168757376 20:326476-326498 GGAGCTGTGGAGGATGGTCCCGG 0: 1
1: 0
2: 4
3: 43
4: 413
1168757368_1168757381 15 Left 1168757368 20:326455-326477 CCTGGTCGAGACCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1168757381 20:326493-326515 TCCCGGCGGGACGGGCCGCTCGG 0: 1
1: 0
2: 0
3: 1
4: 79
1168757368_1168757385 17 Left 1168757368 20:326455-326477 CCTGGTCGAGACCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1168757385 20:326495-326517 CCGGCGGGACGGGCCGCTCGGGG 0: 1
1: 0
2: 0
3: 18
4: 125
1168757368_1168757386 25 Left 1168757368 20:326455-326477 CCTGGTCGAGACCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1168757386 20:326503-326525 ACGGGCCGCTCGGGGACAAGCGG 0: 1
1: 0
2: 0
3: 3
4: 48
1168757368_1168757377 1 Left 1168757368 20:326455-326477 CCTGGTCGAGACCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1168757377 20:326479-326501 GCTGTGGAGGATGGTCCCGGCGG 0: 1
1: 0
2: 2
3: 17
4: 191
1168757368_1168757383 16 Left 1168757368 20:326455-326477 CCTGGTCGAGACCCCGGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1168757383 20:326494-326516 CCCGGCGGGACGGGCCGCTCGGG 0: 1
1: 0
2: 0
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168757368 Original CRISPR CCCGCCCCGGGGTCTCGACC AGG (reversed) Exonic