ID: 1168757601

View in Genome Browser
Species Human (GRCh38)
Location 20:327248-327270
Sequence CAGAGAAGGCGGGCCGGGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 918
Summary {0: 1, 1: 0, 2: 1, 3: 107, 4: 809}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168757601_1168757616 1 Left 1168757601 20:327248-327270 CCTCGCCCGGCCCGCCTTCTCTG 0: 1
1: 0
2: 1
3: 107
4: 809
Right 1168757616 20:327272-327294 GTTAGGGGGGCGATGCGGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 49
1168757601_1168757617 4 Left 1168757601 20:327248-327270 CCTCGCCCGGCCCGCCTTCTCTG 0: 1
1: 0
2: 1
3: 107
4: 809
Right 1168757617 20:327275-327297 AGGGGGGCGATGCGGCCGGGTGG 0: 1
1: 0
2: 1
3: 15
4: 223
1168757601_1168757615 0 Left 1168757601 20:327248-327270 CCTCGCCCGGCCCGCCTTCTCTG 0: 1
1: 0
2: 1
3: 107
4: 809
Right 1168757615 20:327271-327293 GGTTAGGGGGGCGATGCGGCCGG 0: 1
1: 0
2: 1
3: 3
4: 110
1168757601_1168757614 -4 Left 1168757601 20:327248-327270 CCTCGCCCGGCCCGCCTTCTCTG 0: 1
1: 0
2: 1
3: 107
4: 809
Right 1168757614 20:327267-327289 TCTGGGTTAGGGGGGCGATGCGG 0: 1
1: 0
2: 0
3: 9
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168757601 Original CRISPR CAGAGAAGGCGGGCCGGGCG AGG (reversed) Exonic
900085746 1:895162-895184 AAGAACAAGCGGGCCGGGCGTGG - Intergenic
900221320 1:1510782-1510804 CAGAAAATGCCGGCCAGGCGCGG - Intergenic
900599285 1:3496246-3496268 CAGAGCTGGCGGGGTGGGCGGGG - Intronic
900624048 1:3600133-3600155 CAGGGAAGGCAGCCCGGGCTGGG - Intronic
900934142 1:5754724-5754746 AAGACAAGGTGGGCCGGGCACGG - Intergenic
901309108 1:8255291-8255313 CAGGGAACCCTGGCCGGGCGAGG - Intergenic
901385682 1:8907198-8907220 AATAGAAATCGGGCCGGGCGCGG - Intergenic
901409704 1:9073795-9073817 AAGAGAATGCTGGCCGGGCGCGG + Intronic
901581133 1:10244600-10244622 AAAAAAAGGAGGGCCGGGCGCGG - Intronic
901756614 1:11445071-11445093 CAGAGAGGACGGGCTGGGCTGGG - Intergenic
901823193 1:11843456-11843478 AAGAGCAGCAGGGCCGGGCGTGG - Intergenic
901852367 1:12023703-12023725 AAGAGAAGACAGGCCGGGCACGG + Intronic
902196011 1:14798722-14798744 AAAAGAAAGTGGGCCGGGCGTGG - Intronic
902402000 1:16162913-16162935 AAGAAAAAGGGGGCCGGGCGCGG + Intergenic
902413669 1:16226681-16226703 CAGAGATGGTGGGCAGGGCTGGG + Intergenic
902631026 1:17704759-17704781 GAGAGCAGGGGGGCCGGGCGCGG - Intergenic
902920514 1:19663981-19664003 CAGAGAAAGTGGGCCCAGCGAGG - Intergenic
903046424 1:20567443-20567465 CACAGAAAGGAGGCCGGGCGCGG - Intergenic
903111219 1:21135891-21135913 CAAAGAACACAGGCCGGGCGCGG + Intronic
903136305 1:21311380-21311402 AAGAGCATGCGGGCCGGGCATGG + Intronic
903164092 1:21509174-21509196 CCGAGAGTGCGGGGCGGGCGAGG + Intergenic
903291770 1:22318627-22318649 CAGAGGGGGCGGACCTGGCGGGG - Intergenic
903335022 1:22618969-22618991 CAGAGATGGTGGGCAGGGCGGGG - Intergenic
903454655 1:23478955-23478977 CAGAGAAGAGGGGCAGGGCCTGG - Intronic
903462194 1:23527851-23527873 AAGAAAAGGAGGACCGGGCGTGG + Intronic
903552537 1:24167985-24168007 AAGAGGAGGCCAGCCGGGCGCGG - Intronic
903907459 1:26696670-26696692 CAGCGGCGGCGGGCCCGGCGCGG + Exonic
903954115 1:27013023-27013045 CTGAGAAGGAGGGCGGGGCAGGG - Intergenic
904056648 1:27675140-27675162 TAGAAAACGCAGGCCGGGCGCGG - Intergenic
904134229 1:28298798-28298820 AAGAGAAGGCAGGCCGGGTGCGG + Intergenic
904162252 1:28530622-28530644 CACAGAGGGCGCCCCGGGCGCGG - Intronic
904181072 1:28667066-28667088 AAGAAAAGAAGGGCCGGGCGCGG + Intergenic
904199780 1:28812247-28812269 CAGAGACAGCGGGGCGGCCGGGG + Exonic
904209078 1:28873979-28874001 CTGAGAAACCTGGCCGGGCGCGG + Intergenic
904486968 1:30831521-30831543 AAGAGAATGTGGGCCGGGTGCGG + Intergenic
904501148 1:30913514-30913536 CAGGGAAGGCTGGCCGAGCCTGG - Intergenic
904560738 1:31395514-31395536 GACAGAAGGCGGGGCGGGCGCGG - Intergenic
904853326 1:33475956-33475978 GAGAGAAAGAGGGCCGGGCGCGG - Intronic
905097075 1:35482112-35482134 AACAGAAAGCAGGCCGGGCGTGG - Intronic
905110043 1:35588426-35588448 CAGTGAAAGCCGGCCGGGCACGG - Exonic
905174129 1:36125501-36125523 CTGAGAAGGACGGCCAGGCGTGG + Intergenic
906167292 1:43696212-43696234 CAGAGAAGGCAGGGCTGGTGTGG + Intronic
906341734 1:44986723-44986745 GAGGGAAGGCGGGCCGGAGGGGG + Intergenic
907361592 1:53920674-53920696 AAGAGAAAGAGGGCCGGGTGTGG + Intronic
909585421 1:77282679-77282701 CAGAGAGTGCGGCCCGGCCGCGG - Intronic
910288784 1:85580793-85580815 CGGAGAAGGCGCGGAGGGCGCGG - Exonic
910795849 1:91096871-91096893 AAAAAAAGGAGGGCCGGGCGTGG - Intergenic
910885748 1:91961865-91961887 CAGCCAAGGTTGGCCGGGCGCGG + Intronic
910931124 1:92443447-92443469 CAGAGGAGGCAGGCCGGGTGCGG + Intergenic
911219678 1:95234015-95234037 CAGGGCAGACGGGGCGGGCGGGG - Intronic
912349404 1:108997464-108997486 GAAAGAAGGAGGGCTGGGCGCGG + Intronic
912371688 1:109178672-109178694 CAGTGGAGGTGGGCCGGGTGTGG + Intronic
912547146 1:110458941-110458963 GAGAGAGAGGGGGCCGGGCGCGG + Intergenic
912802044 1:112725846-112725868 TAGAGAAGGAGGGCTGGGTGCGG + Intronic
913671051 1:121097652-121097674 GAGAGCAGGCGGGCCCGGGGCGG - Intergenic
914416990 1:147493485-147493507 CAGGGAAGGCGGGAAGGCCGGGG + Intergenic
914468172 1:147949773-147949795 GAGAGACGGCTGGCCGGGCAGGG + Intronic
914824756 1:151132762-151132784 CGGAGAGCGCGGGCCGGGCGGGG + Exonic
914836757 1:151213177-151213199 AAAAAAAGGCAGGCCGGGCGCGG - Intronic
915442686 1:155955406-155955428 GGGAGAAGGTCGGCCGGGCGCGG - Intronic
915522387 1:156455172-156455194 GAGGGAAAGCTGGCCGGGCGTGG - Intergenic
915835514 1:159172402-159172424 CAGAGAAGGGGGCCTGGGTGAGG + Intronic
916715940 1:167446701-167446723 CAGATAATGGGGGCCAGGCGCGG + Intronic
916758002 1:167791594-167791616 CAGAGAAGAGGGGCTGGGCCTGG + Exonic
917826551 1:178827683-178827705 CAGAGAGTATGGGCCGGGCGCGG - Intronic
917944572 1:179955231-179955253 AAGAGAGGCGGGGCCGGGCGCGG + Intronic
917956983 1:180109406-180109428 CAGAGAAAGTGGGCCGAGCGCGG - Intronic
918300572 1:183200098-183200120 AATAGAAAGAGGGCCGGGCGCGG + Intronic
918970981 1:191418778-191418800 AGTAGAAGGCAGGCCGGGCGTGG - Intergenic
919311498 1:195916221-195916243 CAGAAAATTGGGGCCGGGCGCGG + Intergenic
919992765 1:202720291-202720313 AAAGGAAGGCTGGCCGGGCGCGG - Intergenic
920190426 1:204190419-204190441 CAGAGCATGCGGGGCGGGGGCGG - Exonic
920399498 1:205668316-205668338 CAGGGAAGGCGGCCCTGGAGCGG - Intronic
920575547 1:207057155-207057177 CAGAAATGGAGGGCCGGGTGTGG + Intronic
921083124 1:211760167-211760189 TAGAGATATCGGGCCGGGCGTGG + Intronic
921381249 1:214526799-214526821 GAGAGCAGGTGGGCCGGGCGCGG + Intronic
921401976 1:214734600-214734622 AAGAGAGGCCTGGCCGGGCGTGG - Intergenic
921562452 1:216675068-216675090 AAGGGAAGGTGGGCCGGGCACGG + Intronic
922459447 1:225803594-225803616 TAGAATAGGAGGGCCGGGCGTGG - Intergenic
922796102 1:228340633-228340655 CAGAGGAGGCGGGGCAGGGGAGG - Intronic
923119064 1:230973785-230973807 AAGAGCAGAGGGGCCGGGCGTGG + Intronic
923189099 1:231603227-231603249 TACAGAAGCCTGGCCGGGCGTGG + Intronic
923481200 1:234385786-234385808 AAGTGAAGCCTGGCCGGGCGTGG - Intergenic
923501963 1:234572585-234572607 CAGTGTAAGCTGGCCGGGCGCGG + Intergenic
924007742 1:239630881-239630903 CAGATAGGGAGGGCCGGGGGAGG + Intronic
924078499 1:240366839-240366861 CAGGGATAGAGGGCCGGGCGCGG - Intronic
924156289 1:241180082-241180104 CACAGAAAGTGGGCCGGGCGCGG + Intronic
924161670 1:241239255-241239277 GAGAGAGGGATGGCCGGGCGCGG - Intronic
924415284 1:243850689-243850711 CAGAGGCGGCGGGCAGGGCCGGG - Intronic
924934866 1:248759150-248759172 GAGAGAAGGCGGGTCAGGGGTGG - Intergenic
1063054449 10:2489237-2489259 AAGAGAAGGAGGGCCGGGCACGG + Intergenic
1063244084 10:4200801-4200823 TAGACAAAGCAGGCCGGGCGTGG + Intergenic
1063454148 10:6171343-6171365 TAGAGAAGAAGGGCCGGGCCCGG - Intronic
1063563521 10:7150890-7150912 CAGGGAAGGTGTGGCGGGCGGGG + Intergenic
1063571074 10:7215108-7215130 CAGAGAAAACAGGCTGGGCGTGG + Intronic
1063921692 10:10939662-10939684 CGGAAAAGCCAGGCCGGGCGCGG + Intergenic
1064178934 10:13099003-13099025 CAGTGCAGGAGGGCCAGGCGCGG - Intronic
1064232473 10:13541439-13541461 CAGAGAAGTAGGGCAGGGTGGGG - Intergenic
1064764050 10:18652847-18652869 CAGAGAAAATGGGCTGGGCGTGG - Intronic
1065015562 10:21459790-21459812 CAAAGAAGCTGGGCCGGGCAAGG + Intergenic
1065133015 10:22641749-22641771 AAGAGAAGGTAGGCCGGGCATGG - Intronic
1065352655 10:24809479-24809501 CATAGAAAGCTGGCCGGGCGCGG - Intergenic
1065400564 10:25295701-25295723 AAGGGAAGTCAGGCCGGGCGCGG - Intronic
1066129072 10:32372729-32372751 AAGATAAGTCAGGCCGGGCGCGG + Intronic
1066464423 10:35640388-35640410 CAGCGGTGGCGCGCCGGGCGCGG - Exonic
1066756964 10:38721178-38721200 CAGAGAAGGGTGGCCGGGCATGG - Intergenic
1067497824 10:46775114-46775136 CAGGGAGGGCGGCCCGAGCGCGG - Intergenic
1067596825 10:47565300-47565322 CAGGGAGGGCGGCCCGAGCGCGG + Intergenic
1067908755 10:50322540-50322562 ATGAGAAGAGGGGCCGGGCGCGG + Intronic
1068805123 10:61186616-61186638 CACAGAAGGTAGGCCAGGCGCGG + Intergenic
1069502845 10:68969566-68969588 CACAGATATCGGGCCGGGCGTGG - Intronic
1071616606 10:87081080-87081102 AAGAGGCGGCTGGCCGGGCGGGG - Intronic
1071616657 10:87081208-87081230 AAGAGGCGGCTGGCCGGGCGGGG - Intronic
1072241337 10:93497826-93497848 CAGGGAAAGGTGGCCGGGCGCGG + Intronic
1072583745 10:96763388-96763410 GAGATAATGCAGGCCGGGCGCGG + Intergenic
1072730829 10:97845411-97845433 TAAAGAAGGCAGGCCGGGCATGG - Intergenic
1073429103 10:103474743-103474765 AAGATGAGGGGGGCCGGGCGTGG - Intronic
1073463528 10:103680267-103680289 TAAAGAAGGCAGGCCGGGTGTGG - Intronic
1074996985 10:118766254-118766276 AAGAGGAGGTTGGCCGGGCGCGG + Intergenic
1075851357 10:125590404-125590426 AAGAGAAGGAGGGCCAGGCGTGG - Intronic
1076434825 10:130433141-130433163 CAGAGCAGGCGGGCCAGGAGAGG + Intergenic
1076797362 10:132804843-132804865 CAGAGAGGACGGCCAGGGCGTGG + Intergenic
1077056995 11:598640-598662 CACAGAAGCCGCGCCGGGCCCGG + Intronic
1077314682 11:1913434-1913456 CAGAAAGCGGGGGCCGGGCGCGG - Intergenic
1077331791 11:1987213-1987235 CAGAGAAGGCATGCTGGGCTGGG + Intergenic
1077334303 11:1996682-1996704 CAGACTAGGCGAGGCGGGCGGGG - Intergenic
1077457096 11:2687794-2687816 CAGAGGAGGGGGGCCAGGCTGGG - Intronic
1077580255 11:3412982-3413004 CACAGGAGGCTGGCCGGGCGCGG - Intergenic
1077582647 11:3426735-3426757 GAGAGAATGAGGGCCGGGCGTGG + Intergenic
1078541999 11:12220382-12220404 CAGAGAACGCGGCCCTGGTGCGG + Exonic
1078667881 11:13341183-13341205 CAGAGCAGGCTGGCCAGGCGTGG - Intronic
1078709912 11:13781209-13781231 CAGAGATGGCAGGCCGGTTGGGG - Intergenic
1079076598 11:17388741-17388763 CTGGGAAGGCAGGCTGGGCGGGG - Intronic
1079095888 11:17509803-17509825 CACAGAAGGCGGGGGAGGCGGGG + Exonic
1079873338 11:25827824-25827846 ACTAGAAGGCAGGCCGGGCGCGG + Intergenic
1080771555 11:35346804-35346826 CAGAGAAGAGGGGCAGGGCAGGG + Intronic
1081752996 11:45525380-45525402 CATAGAAGCTGGGCCGGGCTGGG + Intergenic
1081796086 11:45820968-45820990 CAGAAAAAGTAGGCCGGGCGCGG + Intergenic
1081819505 11:45978009-45978031 CAGAGATGGTGGGCCGGTTGCGG + Intronic
1081831633 11:46120448-46120470 CAGAGGCGGCGTGCCGGGGGCGG - Intronic
1081913466 11:46715995-46716017 GGGACAAGGCAGGCCGGGCGCGG - Intergenic
1082764745 11:57158082-57158104 CAGAGAAGCTGGGCTGGGTGGGG - Intergenic
1082849365 11:57752237-57752259 AAGAGAAGGCGGGCTTGGCTGGG + Intronic
1083335205 11:61917899-61917921 TAGGGAAGGAGGGCCGGGTGAGG - Intronic
1083409674 11:62483434-62483456 AAGAAAGGGCGGGCCGGGCGCGG + Intronic
1083435088 11:62637291-62637313 TAGGGAAGGCTGGCCGGGTGTGG + Intronic
1083620613 11:64047604-64047626 GAGGGAAGGAAGGCCGGGCGCGG + Intronic
1084126631 11:67103373-67103395 AAGAGAAAGGGGGCCGGGTGCGG - Intergenic
1084188411 11:67487577-67487599 AAGAGTGGGTGGGCCGGGCGCGG - Intronic
1084201602 11:67562571-67562593 CAGACAAATGGGGCCGGGCGTGG + Intergenic
1084272289 11:68035727-68035749 CAGGCAAGGCAGGCCGGGCACGG + Intronic
1084393667 11:68894972-68894994 AAGAGTGGGCAGGCCGGGCGTGG + Intronic
1084832875 11:71783290-71783312 GAGAGAATGAGGGCCGGGCATGG - Intergenic
1084835228 11:71797020-71797042 CACAGGAGGCTGGCCGGGCGCGG + Intronic
1085396704 11:76210169-76210191 CAGAAGAGGGGGGCCGGGCCGGG + Intronic
1085644982 11:78217044-78217066 CAGAGGAGGAGGGCAGGGCTTGG - Exonic
1085805718 11:79634037-79634059 AAGAGAATGAGGGCTGGGCGCGG - Intergenic
1086362059 11:86069360-86069382 CACAGACGCCGGGCGGGGCGGGG + Intronic
1087244164 11:95814648-95814670 TACACAAGGCTGGCCGGGCGTGG - Intronic
1087814276 11:102641263-102641285 CAGAGGAGGCTGGCGGGGCCAGG + Intergenic
1088268116 11:108006914-108006936 CTGATAAAGCGGGCCTGGCGTGG - Intergenic
1089225249 11:116914491-116914513 TTGAGGAGGCAGGCCGGGCGTGG - Intronic
1089481627 11:118810310-118810332 CAGAGGAGGATGGCCGGGTGCGG + Intergenic
1089536659 11:119164664-119164686 AAGAGAAAGAGGGCCGGGCATGG - Intergenic
1090294150 11:125571584-125571606 CAGAAAAGACCAGCCGGGCGTGG + Intronic
1090312409 11:125753224-125753246 AACAGAAGGCAGGCAGGGCGCGG + Intergenic
1090815594 11:130291425-130291447 AATGGAAGGCTGGCCGGGCGCGG - Intronic
1091221176 11:133930925-133930947 CAGAGCAGGCTGGCTGGGGGCGG - Intronic
1202814772 11_KI270721v1_random:42389-42411 CAGAGAAGGCATGCTGGGCTGGG + Intergenic
1202817286 11_KI270721v1_random:51864-51886 CAGACTAGGCGAGGCGGGCGGGG - Intergenic
1091510804 12:1123702-1123724 TACATAAAGCGGGCCGGGCGCGG + Intronic
1091807477 12:3366475-3366497 CTGAGAGGGCGGGTAGGGCGGGG - Intergenic
1092219823 12:6705357-6705379 GACAGGAGGAGGGCCGGGCGCGG - Intergenic
1092407838 12:8233400-8233422 CACAGGAGGCTGGCTGGGCGTGG - Intergenic
1092410238 12:8247195-8247217 AAGAGAATGAGGGCCGGGCATGG + Intergenic
1092822881 12:12370013-12370035 AAGTGAAGGTGGGCCGGGCGTGG - Intronic
1093394966 12:18669956-18669978 AAGAGGAAGAGGGCCGGGCGCGG - Intergenic
1093478266 12:19578981-19579003 TACAGAAGGCTGGCCGGGCATGG + Intronic
1093585535 12:20831066-20831088 TAAAGAAGCCAGGCCGGGCGCGG + Intronic
1094401772 12:30069737-30069759 TAGAGCAGGAAGGCCGGGCGTGG + Intergenic
1095962752 12:47845680-47845702 GAGAGAAGGCTGGCTGGGCAGGG + Intronic
1096145966 12:49278879-49278901 TAGAGAAGTGTGGCCGGGCGCGG - Intergenic
1096908039 12:54953808-54953830 TAGAGAAGGTAGGCCGGGCACGG - Intronic
1099805120 12:87508653-87508675 AAGACAAAGGGGGCCGGGCGCGG - Intergenic
1100362024 12:93888133-93888155 TAGAGATGGCAGGCCGGGCGCGG + Intronic
1100517248 12:95340120-95340142 CTGAGGTGGCCGGCCGGGCGCGG - Intergenic
1100913027 12:99387325-99387347 TAAAGAAGCCTGGCCGGGCGCGG + Intronic
1101347481 12:103899935-103899957 AAGAAATGGGGGGCCGGGCGCGG - Intergenic
1101541998 12:105673713-105673735 AAGAGAATGCTGGCCGGGCACGG - Intergenic
1101606054 12:106248155-106248177 CGGAGAGGGAGGGCCGGGCGGGG + Intronic
1101924477 12:108959642-108959664 AAGAGAAAGCTGGCCAGGCGCGG - Intronic
1102248305 12:111368892-111368914 GAGGTAAGGCGGGCCTGGCGGGG - Exonic
1102679954 12:114684603-114684625 GCGAGCAGGCGAGCCGGGCGGGG + Intergenic
1103087405 12:118072173-118072195 GAAAGAAAGAGGGCCGGGCGCGG + Intronic
1103267358 12:119642162-119642184 CAGATTATGCTGGCCGGGCGTGG + Exonic
1103610557 12:122121661-122121683 CAGAGAGGGCAGGCCGGGCATGG - Intronic
1103713150 12:122928177-122928199 AAGACAAGGCTGGCCAGGCGCGG + Intronic
1103742010 12:123097331-123097353 GGGAGATGGCAGGCCGGGCGCGG - Intronic
1103759223 12:123235771-123235793 AAGAGAAAGTTGGCCGGGCGTGG + Intronic
1104796935 12:131526629-131526651 ATGTGAAGGCAGGCCGGGCGTGG - Intergenic
1104809676 12:131612653-131612675 CAGAGAAGGGGGCCGAGGCGGGG - Intergenic
1104841538 12:131828268-131828290 CGGACACGGCGGGGCGGGCGGGG + Intergenic
1104975522 12:132550302-132550324 CAGAGAGGCCTGGCGGGGCGGGG + Intronic
1105019070 12:132804527-132804549 CAGGGAAGGAGGGCGTGGCGGGG + Intronic
1106129899 13:26931551-26931573 AAGACAAGTCTGGCCGGGCGCGG + Intergenic
1106207493 13:27613479-27613501 CAGTGGAAGCAGGCCGGGCGTGG + Intronic
1106250483 13:27978531-27978553 CGGGGCAGGGGGGCCGGGCGCGG - Intronic
1107614868 13:42155723-42155745 TACAGAAGGTGGGTCGGGCGTGG - Exonic
1107682011 13:42861815-42861837 AAGACAAGGCAGGCCAGGCGTGG - Intergenic
1108022772 13:46145617-46145639 AAAAGAGGGCAGGCCGGGCGCGG + Intronic
1108404444 13:50085710-50085732 GAAAGAATGCAGGCCGGGCGCGG + Intronic
1108579627 13:51817639-51817661 GAGAGAAAGCAGGCTGGGCGGGG - Intergenic
1108617565 13:52149187-52149209 AAGAAAAGGTGGGCTGGGCGCGG - Intronic
1109979282 13:69885228-69885250 AAGAAAAGAAGGGCCGGGCGCGG - Intronic
1112290823 13:98143115-98143137 CAGAGGCGGCGGGTCCGGCGCGG + Intronic
1112402470 13:99087672-99087694 CGGAGAGGGCGCGCCAGGCGGGG + Intergenic
1113195360 13:107797497-107797519 AACAGGAGGTGGGCCGGGCGCGG - Intronic
1113626724 13:111853265-111853287 CAGAGAAGACGGGGCACGCGTGG + Intergenic
1113991863 14:16034276-16034298 AAGAAAAGGCAGGCCGGGCGAGG - Intergenic
1114325445 14:21584263-21584285 AAGACAAGGCAGGCTGGGCGCGG - Intergenic
1114517233 14:23307932-23307954 CAGAGAAGGTGCGCCGGAAGCGG - Exonic
1115593529 14:34887000-34887022 AAGAGAAATCAGGCCGGGCGCGG + Intergenic
1116102275 14:40455414-40455436 CAAAAAAGAAGGGCCGGGCGCGG + Intergenic
1116644272 14:47506722-47506744 AAAAGAATGCAGGCCGGGCGGGG + Intronic
1116836048 14:49769644-49769666 AATAGAAAGGGGGCCGGGCGCGG + Intronic
1117057917 14:51931954-51931976 AAGAAAATGTGGGCCGGGCGCGG + Intronic
1117377417 14:55129190-55129212 CGGGAGAGGCGGGCCGGGCGGGG + Exonic
1117898663 14:60511408-60511430 CAGTGAAGCCAGGCCGGCCGCGG - Exonic
1118163635 14:63315203-63315225 AAGGCAAGGCTGGCCGGGCGTGG - Intronic
1118765519 14:68906980-68907002 AACAGAAGGGGGGCTGGGCGCGG + Intronic
1119602474 14:75985897-75985919 CAGAGAAGTCGGGGCCGGCGGGG - Intronic
1119731039 14:76951217-76951239 CAGAGAAACCGTGCTGGGCGTGG - Intergenic
1120882736 14:89426939-89426961 TAGAAGAGGAGGGCCGGGCGCGG + Intronic
1122467071 14:101941048-101941070 GAGAGAAGGTGGGCCTGGCGAGG + Intergenic
1122518951 14:102329256-102329278 CAAAGAAATTGGGCCGGGCGTGG - Intronic
1122625308 14:103082483-103082505 CGTAGATGGTGGGCCGGGCGCGG + Intergenic
1122634411 14:103123388-103123410 CGGGGAAGGAGGGGCGGGCGGGG + Intergenic
1122659098 14:103282488-103282510 TAAAGAATGCAGGCCGGGCGTGG + Intergenic
1122673317 14:103389072-103389094 AAGAAAAGGCAGGCCGGGTGTGG + Intronic
1122721299 14:103724030-103724052 CAGAGAAGGGGTGCAGGGCAGGG + Intronic
1122955662 14:105069755-105069777 CTGAGCAGGGGGGCCCGGCGAGG - Intergenic
1123041362 14:105491537-105491559 GAGGGCAGGCGGGCCGGGTGGGG + Intronic
1123190344 14:106563739-106563761 TGGAGAGGACGGGCCGGGCGCGG + Intergenic
1123467964 15:20530113-20530135 AACAGAAGGTGGGCAGGGCGGGG + Intergenic
1123650149 15:22470929-22470951 AACAGAAGGTGGGCAGGGCGGGG - Intergenic
1123740555 15:23279771-23279793 AACAGAAGGTGGGCAGGGCGGGG - Intergenic
1123746443 15:23322787-23322809 AACAGAAGGTGGGCAGGGCGGGG + Intergenic
1123808350 15:23897800-23897822 CAGGCGAGGCGGACCGGGCGCGG + Intergenic
1124278710 15:28346104-28346126 AACAGAAGGTGGGCAGGGCGGGG + Intergenic
1124303989 15:28565504-28565526 AATAGAAGGTGGGCAGGGCGGGG - Intergenic
1124444940 15:29722293-29722315 CAGAGCAGCAGGGCCGGGCCTGG - Intronic
1124532870 15:30521979-30522001 AATAGAAGGTGGGCAGGGCGGGG - Intergenic
1124765786 15:32485665-32485687 AACAGAAGGTGGGCAGGGCGGGG + Intergenic
1125850222 15:42896033-42896055 CAGAAAAGACAGGCCGGGTGTGG + Intronic
1125933579 15:43616604-43616626 CAGTGAAGGAGGGCAGGGGGTGG + Exonic
1125946677 15:43716066-43716088 CAGTGAAGGAGGGCAGGGGGTGG + Intergenic
1126797089 15:52268272-52268294 TAGAAATGGCTGGCCGGGCGCGG + Intronic
1127083853 15:55407041-55407063 TAGAGACGGCGGGGCGGGGGGGG - Intronic
1127852299 15:62924471-62924493 AAGAAATTGCGGGCCGGGCGCGG - Intergenic
1127854371 15:62942545-62942567 CAGAGAAGGGGGGCCAGTCTGGG - Intergenic
1128134614 15:65253618-65253640 AAGAGAATGAAGGCCGGGCGCGG - Intronic
1129298323 15:74611743-74611765 CAGAGACAGCGGGCAGGGCTGGG + Intronic
1129817426 15:78566960-78566982 AAGAAATGGCGGGCCGGGCGCGG + Intronic
1130198653 15:81804983-81805005 CATAAAAGCCAGGCCGGGCGAGG - Intergenic
1130421148 15:83748355-83748377 CAGAGTAGGCAGGCTGGGCATGG + Intronic
1130532271 15:84756528-84756550 CAGAGAAGGGGGCCCAGGGGTGG + Intronic
1131052304 15:89357022-89357044 CAGAGAAAAAGGGCCGGGCTTGG + Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131367127 15:91851169-91851191 CAAAAAGGGCTGGCCGGGCGTGG + Intergenic
1132015281 15:98309760-98309782 AAGAGGAGGCAGGCTGGGCGCGG - Intergenic
1132144056 15:99416417-99416439 AAGAGAAGGCGGGCAAGGTGGGG + Intergenic
1132314380 15:100879668-100879690 CAGGGGCGGCGGGCGGGGCGGGG + Exonic
1132397464 15:101484679-101484701 CACACAAAGCAGGCCGGGCGTGG - Intronic
1132400764 15:101503499-101503521 CAAAGAATACGGGCCGGGCACGG + Intronic
1132789461 16:1677600-1677622 GAGAGAAGGGGAGCGGGGCGCGG - Exonic
1132925950 16:2429251-2429273 CGGAGCAGGCGGGGAGGGCGTGG + Intergenic
1132942123 16:2513643-2513665 CAGAGGAGGCGGGGCGTCCGAGG + Intronic
1133107937 16:3525855-3525877 AAGAGAATGGGGGCTGGGCGTGG - Intronic
1133351231 16:5101991-5102013 AAGAGAATGAGGGCCGGGCATGG + Intergenic
1133414681 16:5597235-5597257 CAGAGAAAGCGGGAGGGGGGTGG - Intergenic
1133759218 16:8785092-8785114 AAAAAAAGGGGGGCCGGGCGTGG - Intronic
1134366451 16:13583494-13583516 AAGAGAAACCTGGCCGGGCGCGG - Intergenic
1134537891 16:15041330-15041352 CAGAGAAGGTGGGGTGGGAGTGG - Intronic
1134586956 16:15419856-15419878 AAGAAAATGTGGGCCGGGCGCGG - Intronic
1134637391 16:15802858-15802880 AAGAGAAAGGAGGCCGGGCGTGG + Intronic
1134786693 16:16951221-16951243 AAAAGAAGGCCGGGCGGGCGTGG - Intergenic
1135079473 16:19421938-19421960 GAGAGAGAGAGGGCCGGGCGCGG + Intronic
1135317811 16:21465698-21465720 TAAAGGAGGCCGGCCGGGCGCGG + Intergenic
1135370705 16:21897497-21897519 TAAAGGAGGCCGGCCGGGCGCGG + Intergenic
1135441080 16:22473222-22473244 TAAAGGAGGCCGGCCGGGCGCGG - Intergenic
1136048733 16:27635712-27635734 CATGGATGGCGGGCCTGGCGGGG + Intronic
1136261828 16:29082412-29082434 CAGAGCACACGCGCCGGGCGCGG - Intergenic
1136314582 16:29445380-29445402 TAAAGGAGGCCGGCCGGGCGTGG + Intronic
1136315983 16:29454971-29454993 CAGAGGAGGCGGACCCCGCGGGG + Intronic
1136328025 16:29547148-29547170 TAAAGGAGGCCGGCCGGGCGTGG + Intergenic
1136430560 16:30194313-30194335 CAGAGGAGGCGGACCCCGCGGGG + Intronic
1136442709 16:30287149-30287171 TAAAGGAGGCCGGCCGGGCGTGG + Intergenic
1136720556 16:32316553-32316575 CAGAGAAGGGCGGCCGGGCATGG + Intergenic
1136725618 16:32354945-32354967 CAGAGAAGGGCGGCCGGGCATGG + Intergenic
1136838936 16:33522835-33522857 CAGAGAAGGGCGGCCGGGCATGG + Intergenic
1136843948 16:33561007-33561029 CAGAGAAGGGCGGCCGGGCATGG + Intergenic
1138212047 16:55171758-55171780 AAGAGAATGTGGGCCCGGCGTGG + Intergenic
1139026787 16:62827901-62827923 AAGAGAAATAGGGCCGGGCGCGG - Intergenic
1140073764 16:71677032-71677054 CAGAGAAAGGGGGCCGGGCACGG - Intronic
1140087292 16:71808611-71808633 CAGAGAAGCTGGGCCAGGAGAGG - Intronic
1140114352 16:72028700-72028722 AAGAGAAGGCAGGCCGGGCATGG + Intergenic
1140222915 16:73057617-73057639 GGAAGAAGGCCGGCCGGGCGAGG + Intronic
1140850249 16:78928490-78928512 AAGAAAAGTGGGGCCGGGCGCGG - Intronic
1141546053 16:84769951-84769973 GAAAGAAGGCGGGCCAGGTGTGG + Intronic
1141639795 16:85334466-85334488 CAGAGAAGGGATGCCGGGAGAGG - Intergenic
1141830684 16:86508616-86508638 CAGCGACTGCTGGCCGGGCGCGG - Intergenic
1142049662 16:87950165-87950187 AAGAAAATGCTGGCCGGGCGCGG - Intronic
1142412367 16:89923220-89923242 CGGAGCCTGCGGGCCGGGCGGGG + Intronic
1203000813 16_KI270728v1_random:162809-162831 CAGAGAAGGGCGGCCGGGCATGG - Intergenic
1203005876 16_KI270728v1_random:201217-201239 CAGAGAAGGGCGGCCGGGCATGG - Intergenic
1203132415 16_KI270728v1_random:1699214-1699236 CAGAGAAGGGCGGCCGGGCATGG - Intergenic
1203149099 16_KI270728v1_random:1823122-1823144 CAGAGAAGGGCGGCCGGGCATGG + Intergenic
1203154113 16_KI270728v1_random:1861306-1861328 CAGAGAAGGGCGGCCGGGCATGG + Intergenic
1142608094 17:1093109-1093131 CCGACATGGCTGGCCGGGCGCGG - Intronic
1142616736 17:1140871-1140893 AATAGAAGACTGGCCGGGCGCGG - Intronic
1142823972 17:2495816-2495838 AAGTGAAGACCGGCCGGGCGCGG + Intronic
1142915450 17:3132920-3132942 AAAAGAAGCCAGGCCGGGCGCGG + Intergenic
1143144763 17:4767564-4767586 AAGAAAAGGCTGGCCGGGCGCGG - Intergenic
1143606675 17:7990623-7990645 TAGAGTACACGGGCCGGGCGCGG + Intergenic
1143669499 17:8386666-8386688 AAGAGAAAGGGGGCCGGGCACGG - Intergenic
1143921435 17:10333614-10333636 AAGAGGAGGCCGGCTGGGCGCGG + Intronic
1144092775 17:11872628-11872650 CAGCGAAGGTGGGCCGGGCGCGG + Intronic
1144207402 17:12988786-12988808 CTAAGCAGGCAGGCCGGGCGTGG + Intronic
1144394695 17:14832839-14832861 AAGAAAAAGCAGGCCGGGCGCGG - Intergenic
1144519632 17:15945196-15945218 TACCGAAGGCGCGCCGGGCGAGG - Exonic
1144953021 17:19004201-19004223 CGGGGAGGGCGGGCCGCGCGGGG + Intronic
1144965696 17:19076128-19076150 AAGTGAAGCCGGACCGGGCGCGG - Intergenic
1144982271 17:19176054-19176076 AAGTGAAGCCGGACCGGGCGCGG + Intergenic
1144985952 17:19202185-19202207 AAGTGAAGCCGGACCGGGCGCGG - Intergenic
1145035412 17:19537255-19537277 CAGAGAAGGCAGGCAGGTTGAGG + Intronic
1145048249 17:19636630-19636652 GAGAAAAGGTGGGCAGGGCGTGG + Intergenic
1145765530 17:27456301-27456323 CAGGGAGGGCGGCGCGGGCGCGG + Intergenic
1146277240 17:31523604-31523626 CAGAGAAGGTGGGCCTTGGGTGG + Exonic
1146483363 17:33223471-33223493 TAGAAAAGGGGGGCCGGGCATGG - Intronic
1146710287 17:35035117-35035139 AAAAGAAGGCTGGCTGGGCGCGG + Intronic
1146806705 17:35870758-35870780 TAAAGCAGGTGGGCCGGGCGCGG - Intergenic
1146940200 17:36839236-36839258 CAGTGAAGGAGGGCCAGGTGTGG - Intergenic
1147297836 17:39498511-39498533 AAGAGAAGGATGGCCGGGCGCGG - Intronic
1147410027 17:40243809-40243831 CTGAAAAATCGGGCCGGGCGTGG - Intronic
1147693160 17:42330717-42330739 GAGAAAATGTGGGCCGGGCGCGG - Intronic
1147705525 17:42422571-42422593 CAGGGGACGCGGGCCGGGCGCGG + Intronic
1147939471 17:44036127-44036149 CAGCGGAGGCAGGCCGGGGGAGG - Exonic
1148057970 17:44812935-44812957 AAGAGAAGTTTGGCCGGGCGTGG - Intronic
1148104417 17:45111851-45111873 TAGAGATGGCGGGGGGGGCGGGG - Exonic
1148561287 17:48608130-48608152 AAGAAAACGCCGGCCGGGCGCGG + Intronic
1148704505 17:49617631-49617653 TACAGAAGGCTGGCTGGGCGTGG + Intronic
1148770801 17:50064809-50064831 CAGAGAACTCAGGCCGTGCGGGG - Intronic
1148802926 17:50244018-50244040 ATGAGAAGTCAGGCCGGGCGTGG - Intergenic
1149463626 17:56855713-56855735 CAAGTAAGGCTGGCCGGGCGCGG + Intronic
1149827423 17:59842384-59842406 CAGACAATGTCGGCCGGGCGCGG + Intergenic
1150127324 17:62646312-62646334 GAGAGAGAGGGGGCCGGGCGCGG - Intronic
1150266938 17:63837999-63838021 AAGAGAAGGAGGGCAGGGCTTGG - Intronic
1150700705 17:67444604-67444626 AAGAGAAGGCTGGCCAGGCGCGG + Intronic
1150791844 17:68205615-68205637 CGGAGGAGGAGGGACGGGCGCGG - Intergenic
1151532519 17:74715735-74715757 CAGAGAATTCAGGCCGGGCACGG + Intronic
1151569880 17:74920901-74920923 CAGAGAAGGCGGGACTGGGGCGG + Intronic
1151714248 17:75823423-75823445 CGGAGAAGGCGGGCAGGGCCTGG - Exonic
1151796145 17:76347194-76347216 CAGACAGAGTGGGCCGGGCGCGG + Intronic
1151869174 17:76824928-76824950 AAGAGAAAATGGGCCGGGCGCGG + Intergenic
1151979605 17:77500694-77500716 AAGAAAAGGTAGGCCGGGCGCGG + Intergenic
1152106446 17:78332190-78332212 GAGAGAAAGAGGGCCGGGTGCGG - Intergenic
1152371241 17:79890005-79890027 TAGAGATAGGGGGCCGGGCGCGG - Intergenic
1152425441 17:80216036-80216058 CACAAAAGGGGGGCCGGGCTCGG + Intronic
1152468413 17:80477894-80477916 CAGAGAAGCCGGGGGCGGCGGGG - Intergenic
1152598829 17:81251376-81251398 AAGAGAAGGGGGGCCTGGCAGGG + Intronic
1152697492 17:81804305-81804327 CAGAGACCGCGGGGCGGGCGCGG + Intronic
1152710290 17:81867884-81867906 CAGGGAAGGCCTGCCGGGGGTGG + Exonic
1152748570 17:82052173-82052195 GAGGGGAGGCGGGGCGGGCGCGG - Exonic
1152924100 17:83079737-83079759 CGGAGCCGGCGAGCCGGGCGGGG - Exonic
1153127899 18:1818102-1818124 AAGAAAAGCTGGGCCGGGCGCGG + Intergenic
1154971220 18:21411753-21411775 AATAGAATGGGGGCCGGGCGCGG + Intronic
1155322687 18:24634014-24634036 TAAAGAAGCTGGGCCGGGCGCGG - Intergenic
1155382208 18:25236243-25236265 CAGAGATGAGGGGCTGGGCGCGG + Intronic
1155525908 18:26716000-26716022 GAGAGAAGTGAGGCCGGGCGCGG - Intergenic
1156138190 18:34070307-34070329 AAGGCAAGGCGGGCCGGGCGCGG - Intronic
1156262947 18:35461539-35461561 CTGAGAAGGAGTGCTGGGCGTGG + Intronic
1156601173 18:38608969-38608991 GAGAGAAGGGAGGCCGGGCAGGG + Intergenic
1158076470 18:53536195-53536217 GAGAGAAGCAGGGCCGGGCGCGG + Intergenic
1158178511 18:54685470-54685492 AAGGGAAAGGGGGCCGGGCGCGG + Intergenic
1158878029 18:61751725-61751747 CAGAGAAGGCCGGTGGGGAGAGG + Intergenic
1160140539 18:76317849-76317871 CAGTAAAGAGGGGCCGGGCGTGG + Intergenic
1160193176 18:76732154-76732176 AGGAAAAGGTGGGCCGGGCGCGG - Intergenic
1160499255 18:79394303-79394325 GGGAGAAGGAGGGCGGGGCGGGG + Intergenic
1160698546 19:495841-495863 AAGTGCAGGCGGGCCGGGCGCGG + Intronic
1160699093 19:497632-497654 CAGAGGCGGCGGTCGGGGCGGGG + Intronic
1160702676 19:515740-515762 AAAAGAAAGAGGGCCGGGCGCGG + Intronic
1160719315 19:590382-590404 GCGAGGAGGCGGGCCCGGCGGGG + Exonic
1160824848 19:1074736-1074758 CCGGGAGGGCGGGCTGGGCGGGG + Intronic
1160914163 19:1488869-1488891 GAGAGAAGCCAGGCCTGGCGTGG - Intronic
1160937654 19:1604881-1604903 CATAGAAGCCGGGCTGGGGGTGG - Intronic
1160989122 19:1853419-1853441 CAGGGAAGCAGGGCCGGGCCAGG + Exonic
1160989893 19:1856180-1856202 CAGAGACGGCGGGAGGGGCACGG + Intronic
1161016825 19:1987418-1987440 CGGAGATGGGGGGCCGGGCATGG - Intronic
1161139057 19:2637223-2637245 CAGCAAAGACGGGCCGGGCTCGG - Intronic
1161223608 19:3131601-3131623 CATAGAAACCAGGCCGGGCGCGG + Intergenic
1161276123 19:3418559-3418581 ATGAGACGGCTGGCCGGGCGTGG + Intronic
1161306437 19:3571806-3571828 AAGAGGAAGTGGGCCGGGCGTGG + Intronic
1161317249 19:3623237-3623259 AAAAGAAAGCTGGCCGGGCGTGG + Intronic
1161352250 19:3800336-3800358 GAGAGCAGGATGGCCGGGCGTGG + Intronic
1161412434 19:4123920-4123942 CATAGGGGGCGGGCCGGGAGCGG + Exonic
1161417485 19:4155644-4155666 AAAAGAAAGTGGGCCGGGCGCGG - Intronic
1161449427 19:4336601-4336623 AAGATAATGGGGGCCGGGCGTGG - Intronic
1161528749 19:4773964-4773986 CAATAAAGGCTGGCCGGGCGCGG - Intergenic
1161562350 19:4980716-4980738 GAGACAAAGTGGGCCGGGCGCGG - Intronic
1161790345 19:6355860-6355882 CCGAGGCGGCTGGCCGGGCGGGG - Intergenic
1161945415 19:7433174-7433196 AAAAGAAGGCAGGCCGGGCACGG + Intronic
1161973400 19:7596176-7596198 CGGGGGCGGCGGGCCGGGCGCGG + Intronic
1162070333 19:8149051-8149073 CAGAGAAGGCGCGCCCGGCACGG + Intronic
1162410884 19:10504303-10504325 AAGACAAGGAAGGCCGGGCGCGG - Intergenic
1162675985 19:12298697-12298719 AAGACAATGTGGGCCGGGCGCGG + Intergenic
1162716280 19:12636486-12636508 GAGACAAGGTTGGCCGGGCGCGG - Intronic
1162799421 19:13102757-13102779 GGGAGAAGGCGGGCCGGCCCGGG - Exonic
1163023111 19:14494380-14494402 CAGGCAAGGGGGCCCGGGCGCGG - Intronic
1163051502 19:14688149-14688171 CAAAGAAGTTGGGCCGGGCGGGG - Intronic
1163119615 19:15209398-15209420 TAGAGAAGACAGGCCAGGCGCGG + Intergenic
1163271002 19:16253890-16253912 CAGGGCAGGCGGGGCGGGGGAGG - Intergenic
1163359321 19:16835929-16835951 CAGAGAATACTGGCCAGGCGTGG - Intronic
1163462886 19:17449219-17449241 AAGAGAAAGGAGGCCGGGCGCGG + Intronic
1163755341 19:19103383-19103405 AAGAGAAAACAGGCCGGGCGCGG - Intronic
1163854540 19:19690910-19690932 TAGAGAGGGCCGGGCGGGCGTGG - Intergenic
1163856127 19:19703671-19703693 AAGTGAAGGAGAGCCGGGCGCGG - Intergenic
1163865739 19:19771922-19771944 TAGAAAAGGCTGGTCGGGCGCGG + Intergenic
1165172058 19:33900539-33900561 CCGAGAAGATGGGCCGGGTGTGG + Intergenic
1165334611 19:35160634-35160656 AAGAGAATTGGGGCCGGGCGCGG - Intronic
1165704868 19:37968360-37968382 GAGATGAGGCCGGCCGGGCGCGG - Intronic
1166109513 19:40613678-40613700 CAGTGAGGGGGGGCGGGGCGTGG + Intronic
1166230301 19:41422595-41422617 CAGAGAAGGCAGGTCAGGCCAGG - Intronic
1166798767 19:45443617-45443639 GGGAGCAGGCGGGCCGGGCAGGG + Intronic
1166873898 19:45885911-45885933 CGGGGAAGGGGGGCCGGGCCTGG - Exonic
1166929521 19:46293553-46293575 GATAGAGGCCGGGCCGGGCGCGG + Intergenic
1167229131 19:48270786-48270808 AAGAAAAGAAGGGCCGGGCGCGG + Intronic
1167243019 19:48356414-48356436 AAAAAAAGGAGGGCCGGGCGTGG - Intronic
1167557095 19:50203439-50203461 AAAAGAACGCGGCCCGGGCGCGG - Intronic
1168042510 19:53769678-53769700 AAGAGAATGATGGCCGGGCGCGG - Intergenic
1168098855 19:54130333-54130355 CAGAAATGCCAGGCCGGGCGCGG + Intronic
1168256931 19:55172128-55172150 AAAAGAAGAAGGGCCGGGCGCGG + Exonic
1168356913 19:55706359-55706381 AAGTGAAAGAGGGCCGGGCGTGG + Intronic
1168359353 19:55725734-55725756 CAGGGAACCCAGGCCGGGCGCGG + Intronic
925609347 2:5691418-5691440 CAGGGACGCCGGGCGGGGCGCGG + Intergenic
925610015 2:5694442-5694464 CAGAGGGGGCGGGGCGGGGGAGG + Exonic
925915655 2:8603589-8603611 AAGGGAAGGAGGGCTGGGCGTGG + Intergenic
925995816 2:9292248-9292270 CAGAGAAAGTAGGCTGGGCGTGG + Intronic
926001946 2:9340309-9340331 CAGACATGGCTGGCCGGGCGCGG - Intronic
926005663 2:9371824-9371846 AAAAGAGGGAGGGCCGGGCGCGG + Intronic
926011276 2:9410133-9410155 GAGAGAACTCGGGCTGGGCGCGG - Intronic
926992854 2:18698357-18698379 AAGAGAAAGAGGGCTGGGCGTGG + Intergenic
927189654 2:20508915-20508937 CACTGGAGGTGGGCCGGGCGTGG - Intergenic
927520687 2:23696291-23696313 CAGAGAGAGCGGGCGGGGTGAGG - Intronic
927608912 2:24516480-24516502 AAAAAAAGGCGGGCCGGGCACGG - Intronic
927663021 2:25008805-25008827 GAGAGAAAGCAGGCCGGGTGTGG - Intergenic
928512387 2:32013717-32013739 ATAAGAAGGCAGGCCGGGCGCGG + Intronic
928576980 2:32665135-32665157 CACAGAATGTGGGCTGGGCGTGG - Intronic
928613109 2:33010068-33010090 GGGAGAAGGCTGGCAGGGCGTGG + Intronic
930083938 2:47479018-47479040 CAGATAATTCTGGCCGGGCGTGG - Intronic
930172800 2:48268517-48268539 GAGAGAAAGTGGGCTGGGCGTGG - Intergenic
930420067 2:51140252-51140274 GAGAGAGAGAGGGCCGGGCGCGG + Intergenic
930864719 2:56111176-56111198 TATGGAAGGCAGGCCGGGCGTGG - Intergenic
931360243 2:61571815-61571837 AAGACAAAGCAGGCCGGGCGCGG + Intergenic
932233292 2:70100696-70100718 CAGACAACGGAGGCCGGGCGCGG + Intergenic
932267036 2:70376624-70376646 AAGAAAATGTGGGCCGGGCGCGG - Intergenic
932763944 2:74458494-74458516 CAGCGAAGATGGGCCGGGCAGGG + Exonic
932795968 2:74696486-74696508 AAGAGAGGCAGGGCCGGGCGCGG - Intergenic
933475630 2:82786460-82786482 AAGAGAAGGGGGGCGGGGAGGGG + Intergenic
933670929 2:85006587-85006609 AAGAAAATGAGGGCCGGGCGCGG - Intronic
933709248 2:85313720-85313742 CAGAGCAGGGGGGTCGGGCTTGG + Intergenic
933909995 2:86930841-86930863 CAGCGAAGATGGGCCGGGCAGGG - Intronic
934022730 2:87972547-87972569 CAGCGAAGATGGGCCGGGCAGGG + Intergenic
934320271 2:91965621-91965643 CAGAGAAGGGTTGCCGGGCATGG - Intergenic
934655986 2:96116962-96116984 CAGGGAGGGCAGGGCGGGCGTGG + Intergenic
934744396 2:96749504-96749526 AAGAGAGAGCGGGCCAGGCGTGG + Intergenic
934945759 2:98540220-98540242 AAGAGAAGGAAGGCCGGGCATGG - Intronic
934966861 2:98731132-98731154 CGGAGCCGGCGGGGCGGGCGGGG - Intergenic
935728906 2:106048484-106048506 AAAAGAAGGTGGGCCGGGTGTGG - Intergenic
935914615 2:107935755-107935777 AAGAGAGGGCTGGCCGGGCGCGG + Intergenic
936095296 2:109526600-109526622 AAGAGGAGGTGAGCCGGGCGTGG - Intergenic
936346383 2:111678627-111678649 CAGGGAAGGGGGGCGGGGGGAGG - Intergenic
936620784 2:114095061-114095083 TAGAAAAGAGGGGCCGGGCGTGG - Intergenic
936787548 2:116112074-116112096 AAGATAAGGAGGGCCGGGTGCGG + Intergenic
937216095 2:120314589-120314611 GAGGGAAGGAGGGCCGGGGGAGG - Intergenic
937928711 2:127188207-127188229 CAGAGAGGAAGGGCAGGGCGGGG - Intronic
937952065 2:127396164-127396186 AAGAAAATGTGGGCCGGGCGCGG + Intergenic
937984955 2:127634282-127634304 CAGACAAGGTGGGCCGGGCTGGG + Exonic
938093104 2:128446129-128446151 AAGACAAGGCTGGCCAGGCGTGG - Intergenic
938296303 2:130181689-130181711 AAGCGAAGGCCGGCCGGGCGGGG + Exonic
938460703 2:131494409-131494431 AAGAGAAAGCTGGCCGGGCGCGG + Intergenic
938536669 2:132253864-132253886 GAGAGCAAGCGGGCCGGGCCGGG + Intronic
939067619 2:137503734-137503756 AAGAGAAAGTGAGCCGGGCGCGG + Intronic
939325183 2:140679065-140679087 GAGAGAGGCCTGGCCGGGCGTGG - Intronic
939392493 2:141586650-141586672 GAGAGAAAGGGGGCCGGGCGCGG + Intronic
939584828 2:143991923-143991945 AAGAGGTGGCTGGCCGGGCGGGG - Intronic
939987005 2:148839387-148839409 AAGAGAAAATGGGCCGGGCGCGG - Intergenic
940360317 2:152789934-152789956 CAAAGAAGTGCGGCCGGGCGGGG + Intergenic
940807904 2:158208501-158208523 CAGAGAAGCAGGGCCTGTCGAGG + Intronic
941368801 2:164638623-164638645 CAGAGAAGGCGGGGTTGGAGAGG + Intergenic
941487980 2:166105895-166105917 TACAGAAACCGGGCCGGGCGCGG + Intronic
941824368 2:169876852-169876874 AAGAGACGTAGGGCCGGGCGTGG - Intronic
942276731 2:174328547-174328569 CAGGGAAGGCGGGCGGGCGGGGG + Intergenic
942545038 2:177055100-177055122 CAGACCGGGCGGGCCGGGCGCGG + Intergenic
943429838 2:187785209-187785231 AAGAGAAAAGGGGCCGGGCGCGG - Intergenic
943868179 2:192956220-192956242 TAGTGAAGGATGGCCGGGCGTGG - Intergenic
944832329 2:203545415-203545437 AAGAAAAGTCCGGCCGGGCGTGG + Intergenic
945935332 2:215897974-215897996 CAGAGAGGGTTGGCCAGGCGCGG - Intergenic
946019527 2:216631944-216631966 CACAGAAATGGGGCCGGGCGCGG - Intergenic
946278754 2:218650859-218650881 CAGAGAAAACGGGCCAGGAGAGG - Intronic
946397272 2:219449243-219449265 CAGGGGAGGTGGGCCGGGCCCGG - Exonic
946433985 2:219640229-219640251 AAGAGAAGGAGGGGCGGGGGGGG - Intronic
947632673 2:231664072-231664094 AACAGAGGACGGGCCGGGCGCGG - Intergenic
947868534 2:233418835-233418857 CAGAGCTGGTGGGCTGGGCGGGG + Intronic
948874440 2:240819511-240819533 CAAAACAGGCGGGCGGGGCGGGG - Intronic
948988373 2:241539815-241539837 CAGAGAACACGGGGCGGGGGCGG + Intergenic
949008247 2:241662943-241662965 CCAATAAAGCGGGCCGGGCGCGG + Intronic
1168757601 20:327248-327270 CAGAGAAGGCGGGCCGGGCGAGG - Exonic
1168801982 20:649409-649431 TAGAGAAGTGGGGCCGGGCACGG + Intronic
1168814678 20:728427-728449 CGGAGGCGGCGGGCGGGGCGAGG + Intergenic
1168832360 20:853553-853575 CAGAGAAGGTGGGTGGGGCTGGG + Intronic
1168861974 20:1052077-1052099 CAGAGAGGGCGGGGAGGGGGGGG - Intergenic
1169314042 20:4573262-4573284 AAGTGAAGAGGGGCCGGGCGAGG - Intergenic
1170577499 20:17675532-17675554 CAGAGAAGGGGGGCAGGGAGTGG + Intronic
1170751277 20:19147900-19147922 CAGCCAAGGGCGGCCGGGCGCGG - Intergenic
1170960294 20:21019853-21019875 CAGAGAAAGGGGGCTGGGCAGGG - Intergenic
1171122416 20:22578463-22578485 CTGAGGAGGGGAGCCGGGCGCGG + Intergenic
1171812711 20:29758173-29758195 AAGAAAAGGCAGGCCGGGCGAGG + Intergenic
1171906529 20:30904113-30904135 AAGAAAAGGCAGGCCGGGCGCGG - Intergenic
1172244404 20:33435902-33435924 ATGAGGAGGTGGGCCGGGCGCGG + Intronic
1172391058 20:34565546-34565568 TAGAGGAGCCCGGCCGGGCGCGG - Intronic
1172409347 20:34710132-34710154 TGGAGAAGGCGGGCCAGGTGCGG + Exonic
1172456940 20:35084007-35084029 TACAGAAAGCAGGCCGGGCGCGG + Intronic
1172474467 20:35226702-35226724 GAAGGCAGGCGGGCCGGGCGCGG + Exonic
1172657350 20:36545205-36545227 CAGGGAAACTGGGCCGGGCGCGG + Intronic
1172948625 20:38707355-38707377 GAGATAATGCCGGCCGGGCGTGG - Intergenic
1173243363 20:41317364-41317386 CTGAGACTGCGGGCCGGCCGCGG + Intronic
1173540529 20:43847753-43847775 AAAAAAAGGCAGGCCGGGCGCGG - Intergenic
1173548073 20:43914615-43914637 CAGGGATGCAGGGCCGGGCGGGG + Intergenic
1173744669 20:45427034-45427056 CAGATGAGGCTGGCCGGGCACGG + Intergenic
1173832253 20:46098271-46098293 AAAAGAAGCAGGGCCGGGCGCGG - Intergenic
1174447785 20:50602185-50602207 CAGAGAGGACGGGCCTGGCGTGG - Exonic
1174615413 20:51831699-51831721 AAGAGAAGCTGGGCCGGGCGCGG - Intergenic
1175152400 20:56945577-56945599 AAGAAAAGGGGGGCCGGGCGTGG + Intergenic
1175429500 20:58891616-58891638 CCGGGCGGGCGGGCCGGGCGCGG - Intronic
1175948533 20:62570021-62570043 CAGAGAACGGGGGCAGGGTGTGG + Intronic
1176084021 20:63287783-63287805 CAGCGACGGCGGGGAGGGCGGGG + Exonic
1176234760 20:64049117-64049139 CAGAGAAGGGGGAGAGGGCGGGG - Intronic
1176286688 21:5022453-5022475 CAGAGGAGCCAGGCCGGGGGCGG + Intergenic
1177801704 21:25834514-25834536 CAGAGATGGGGGGCAGGGAGGGG - Intergenic
1178299993 21:31444706-31444728 AAGAGAACGCAGGCCAGGCGCGG + Intronic
1179554143 21:42162030-42162052 CAGAGAAGGGGAGCAGGGAGGGG + Intergenic
1179667430 21:42922448-42922470 GAGTGAAGGAAGGCCGGGCGCGG + Intergenic
1179870493 21:44241022-44241044 CAGAGGAGCCAGGCCGGGGGCGG - Intergenic
1180038671 21:45264645-45264667 CAGGGACGGCCAGCCGGGCGAGG + Exonic
1180109533 21:45641739-45641761 AAGGGAAGGTGGGCCGGGCGCGG - Intergenic
1180308519 22:11149666-11149688 CAGAGAAGGGTGGCCAGGCAAGG - Intergenic
1180315409 22:11273250-11273272 AAGAAAAGGCAGGCCGGGCGAGG + Intergenic
1180339943 22:11610232-11610254 AAGAAAAGGCAGGCCGGGCGCGG - Intergenic
1180546996 22:16511479-16511501 CAGAGAAGGGTGGCCAGGCAAGG - Intergenic
1180593736 22:16960790-16960812 CAGGGAAGGAGGGCAGGGCCAGG - Intergenic
1180724631 22:17937371-17937393 CAAAAAAGATGGGCCGGGCGTGG + Intronic
1180951516 22:19722660-19722682 CAGAGAGGGCCAGCTGGGCGGGG - Exonic
1181087055 22:20445494-20445516 TAGAGATGGGTGGCCGGGCGCGG - Intronic
1181457836 22:23069947-23069969 GAGAGAAGGCGAGCCGGGACTGG + Intronic
1181952341 22:26563617-26563639 GAGGGAGGGAGGGCCGGGCGTGG - Intronic
1182012407 22:27011845-27011867 CAGAGAAGGCCTCCCGGGGGAGG - Intergenic
1182278631 22:29205841-29205863 CAGCGCAGAGGGGCCGGGCGAGG + Exonic
1182589774 22:31369980-31370002 AAGAAAAGACAGGCCGGGCGTGG - Intergenic
1183241440 22:36660636-36660658 CAGGTGAGGCGGGCGGGGCGGGG + Intronic
1183276373 22:36900703-36900725 CAGAGAGGGCAGGCTGGGCTGGG - Intergenic
1183655174 22:39180259-39180281 AAGGCAAGGAGGGCCGGGCGCGG + Intergenic
1183789019 22:40049892-40049914 CAAAGAATGCCAGCCGGGCGCGG - Intronic
1183935631 22:41260555-41260577 AAGAGAAGAGGGGCCGGACGTGG + Intronic
1183943366 22:41309298-41309320 AAAAGAAAGCAGGCCGGGCGCGG - Intronic
1184043682 22:41958863-41958885 CAGCGAAGGGGGGCGGGGTGAGG - Intergenic
1184065001 22:42113505-42113527 AAGAGGACGCAGGCCGGGCGCGG + Intergenic
1184405582 22:44298757-44298779 CAGAGATGGGGGGCCGGGGAGGG + Intronic
1184524074 22:45011250-45011272 CATAGGAGGCCGGCCGGGGGCGG + Intergenic
1184536169 22:45088465-45088487 GAGAGAAGACTGGCCGGGCGTGG - Intergenic
1184572274 22:45333031-45333053 AAGTGAAGACAGGCCGGGCGCGG - Intronic
1184663364 22:45975731-45975753 CACAGTAGGCGCGCAGGGCGCGG + Intronic
1184683411 22:46085137-46085159 CCGGGAAGGCGGGCCGAGGGAGG + Intronic
1185062797 22:48615823-48615845 CAGAGAGGGCTGGCTGGGAGGGG - Intronic
1185351435 22:50341702-50341724 AGGAGAGGGCTGGCCGGGCGCGG + Intergenic
1185368354 22:50447115-50447137 CAGAGCAGCCGGGCAGGGCTGGG + Exonic
1185407655 22:50663849-50663871 AAGAGATGGGGGGCCAGGCGTGG - Intergenic
949540208 3:5026678-5026700 CAGGGAAGGCCGGGCGGGGGTGG - Intergenic
950094281 3:10319790-10319812 GAGAGAAGGCGGGGGGGGGGGGG + Intronic
951140061 3:19148296-19148318 CAGAGACGTCGGTCAGGGCGCGG + Intergenic
952030148 3:29131875-29131897 AAGAACATGCGGGCCGGGCGCGG - Intergenic
952279603 3:31910342-31910364 CAGAGTCAGGGGGCCGGGCGCGG + Intronic
952334314 3:32391831-32391853 TACAGAGGGCGGGCCGGGGGCGG - Exonic
952502246 3:33974520-33974542 AAGAAAAAACGGGCCGGGCGCGG + Intergenic
953944934 3:47138260-47138282 AAAAGAAAGTGGGCCGGGCGCGG - Intronic
953950881 3:47189205-47189227 CAGATAAGGAGGGCTGGGCATGG + Intergenic
953982776 3:47420892-47420914 CTGAGGAGGCGGGCAGGGCAGGG + Intronic
954052075 3:47987902-47987924 AAAAGAAGGCAGGCCGGGCACGG + Intronic
954105752 3:48409066-48409088 CATAGAATGCTGGCCAGGCGTGG - Intronic
954270337 3:49502925-49502947 CAGAAAGTGCTGGCCGGGCGCGG - Intronic
954567618 3:51611844-51611866 GAGAGAAGGTAGGCCAGGCGCGG - Intronic
955887985 3:63620631-63620653 AAGGGAAGGCTGGCCGGGCGCGG - Intergenic
955910496 3:63854716-63854738 AAGAAAAGGAGGGCCGGGCGCGG + Intronic
957053124 3:75425580-75425602 CACAGGAGGCTGGCCGGGCGCGG - Intergenic
957280687 3:78147165-78147187 ATGAGAAGGGGGGCCGGGTGTGG - Intergenic
957766492 3:84632063-84632085 AAGAAAATGGGGGCCGGGCGCGG + Intergenic
958710900 3:97716276-97716298 AAGAAAAGATGGGCCGGGCGCGG + Intronic
959734230 3:109639355-109639377 TAGAAAAGCCTGGCCGGGCGCGG - Intergenic
960689833 3:120334212-120334234 TATAAAAGGTGGGCCGGGCGTGG + Intronic
961080651 3:124024482-124024504 AAGAAAAGAAGGGCCGGGCGCGG - Intergenic
961081787 3:124033811-124033833 CAGGTAAGCCGGGCAGGGCGCGG + Intergenic
961301708 3:125925965-125925987 CACAGGAGGCTGGCCGGGCGCGG + Intergenic
961530914 3:127539877-127539899 AAGAGAAGGCAGGGCTGGCGGGG + Intergenic
961831294 3:129624277-129624299 TAGAGATGGCGGGGCGGGTGGGG - Intergenic
961886756 3:130101887-130101909 CACAGGAGGCTGGCCAGGCGTGG - Intronic
961965106 3:130894150-130894172 GAGAGAGGGCGGGCGGGGAGGGG - Intronic
962575495 3:136752048-136752070 GCGAGCGGGCGGGCCGGGCGCGG - Intronic
962798089 3:138866139-138866161 AAGATAAAGCGGGCTGGGCGTGG + Intergenic
964415051 3:156438723-156438745 CAGTGTAGGCTGACCGGGCGTGG + Intronic
964772917 3:160243440-160243462 CAAAGAATTGGGGCCGGGCGCGG + Intronic
965735033 3:171810494-171810516 GAGAGAGGGCGGGCCGGAGGGGG + Exonic
965874986 3:173305777-173305799 AAATGAAGGTGGGCCGGGCGCGG - Intergenic
965975968 3:174622748-174622770 AAGAGGAATCGGGCCGGGCGCGG + Intronic
966046087 3:175551607-175551629 CACACAAGAGGGGCCGGGCGCGG + Intronic
966146135 3:176814033-176814055 AAGGGAAGGTGGGCTGGGCGCGG - Intergenic
966191149 3:177272639-177272661 AAAAGAAGGCAGGCTGGGCGTGG + Intergenic
966615804 3:181911236-181911258 AAAGGAAGGGGGGCCGGGCGCGG - Intergenic
966657781 3:182378863-182378885 CAGCAAAACCGGGCCGGGCGCGG - Intergenic
966731600 3:183156067-183156089 CACAGATGTTGGGCCGGGCGCGG + Intronic
966997700 3:185299854-185299876 GAGAGAGAGAGGGCCGGGCGCGG - Intronic
968259510 3:197308461-197308483 TAGTGAAGCTGGGCCGGGCGTGG - Intergenic
968413294 4:407252-407274 AGAATAAGGCGGGCCGGGCGCGG + Intergenic
968503301 4:961002-961024 CAGGGGAGGTGGGCCGGGCTGGG - Intronic
968620634 4:1601984-1602006 CAGTGGAGGTGGGCCGGGGGAGG + Intergenic
968643037 4:1724260-1724282 CAGCCAAGGCCGGCCGGGCGTGG - Intronic
968995924 4:3945892-3945914 CACAGGAGGCTGGCCGGGTGCGG - Intergenic
969052800 4:4385376-4385398 CTGAGACGGGGGGCGGGGCGGGG + Intronic
969818036 4:9700349-9700371 CACAGGAGGCTGGCTGGGCGCGG + Intergenic
970417362 4:15872748-15872770 AAGAAAAAGGGGGCCGGGCGCGG + Intergenic
970737912 4:19196026-19196048 CAGTGAAGGGGGGCCGGGGATGG + Intergenic
971347620 4:25825960-25825982 TAGACCAGGCCGGCCGGGCGTGG - Intronic
972218202 4:36921116-36921138 GAGAAAATGTGGGCCGGGCGTGG + Intergenic
972291032 4:37690282-37690304 CAGAAATGGCTGGCCAGGCGCGG + Intergenic
972484040 4:39525797-39525819 TAGAAAATGGGGGCCGGGCGTGG - Intronic
972630273 4:40836184-40836206 AAGACAAAGCTGGCCGGGCGCGG + Intronic
973702186 4:53548066-53548088 CAGAGAAAGCTGGAAGGGCGTGG + Intronic
974001976 4:56520919-56520941 AAGAGAGGTTGGGCCGGGCGTGG + Intronic
975049555 4:69843124-69843146 AAAAGAAGGTGGGCTGGGCGCGG - Intronic
975583044 4:75923826-75923848 AAGGGAAGATGGGCCGGGCGCGG - Intronic
975706677 4:77118910-77118932 AAGAAAAGGCAGGCCAGGCGTGG - Intergenic
975853857 4:78601950-78601972 ATGAGAAGGCAGGCCAGGCGCGG + Intronic
978691553 4:111518828-111518850 CAGAGCAGATGGGCTGGGCGTGG + Intergenic
978795693 4:112705824-112705846 CAGAGCACACGCGCCGGGCGCGG + Intergenic
979340492 4:119516907-119516929 AAGAGAATGAGGGCTGGGCGCGG - Intronic
979628619 4:122875516-122875538 CAAAGAAATAGGGCCGGGCGCGG + Intronic
979859135 4:125671886-125671908 AAGTGAATGCTGGCCGGGCGCGG - Intergenic
981061176 4:140427196-140427218 CAGGGGAGGCCGGCCGGGCTAGG + Intronic
982068547 4:151675200-151675222 CCGAGAAGGAGGGCCAGGCGGGG + Intronic
982981442 4:162141403-162141425 GAGAGAAGGGAGGCCGGGCGCGG - Intronic
983090221 4:163494162-163494184 AAGAGAAGAGGGGCGGGGCGGGG + Intergenic
984212931 4:176873076-176873098 CAGAGAAGGCGGGGAAGGCAGGG - Intergenic
984384327 4:179035688-179035710 AAGAAAATGTGGGCCGGGCGCGG + Intergenic
984424617 4:179566840-179566862 CACAAAAGGTTGGCCGGGCGTGG - Intergenic
984714950 4:182917132-182917154 CGGAGAATGCGGGCGGGGTGGGG - Intronic
985643268 5:1073618-1073640 CCGAGGAGGTGGGCCGGGCGGGG - Exonic
985713434 5:1442868-1442890 CTGAGCATGCTGGCCGGGCGGGG - Intronic
985846603 5:2354186-2354208 CAGAGAAGGCCAGCCAGGTGTGG - Intergenic
986404435 5:7411783-7411805 AAGAGAAGCACGGCCGGGCGCGG + Intronic
986648887 5:9944803-9944825 CTGAGAAGGCGGGCCTGGCAAGG + Intergenic
986723511 5:10577411-10577433 AAGAGAAAGGCGGCCGGGCGCGG - Intronic
987113550 5:14709182-14709204 CTGAGAAAGCAGGCCGGGCATGG - Exonic
987319938 5:16759211-16759233 CATTGAAGGCTGGGCGGGCGCGG - Intronic
987386201 5:17332002-17332024 AAGTGTAGGTGGGCCGGGCGCGG + Intergenic
987855395 5:23413646-23413668 GACAGAAACCGGGCCGGGCGCGG + Intergenic
988325950 5:29768326-29768348 AAGAGCAGGTAGGCCGGGCGCGG + Intergenic
990311297 5:54541316-54541338 AAGACCAGGAGGGCCGGGCGCGG - Intronic
990841951 5:60091760-60091782 AAGAAAATGTGGGCCGGGCGCGG + Intronic
991308613 5:65210160-65210182 CTATGAAGGCCGGCCGGGCGCGG + Intronic
991706519 5:69363492-69363514 CAGAAAGGCCGGGCTGGGCGCGG + Intronic
992088621 5:73299152-73299174 GAGCGCCGGCGGGCCGGGCGGGG - Intergenic
992510893 5:77434037-77434059 AAGAGAAACAGGGCCGGGCGTGG + Intronic
992654248 5:78892544-78892566 TAGAGAATGCAGGCTGGGCGTGG - Intronic
993017793 5:82555238-82555260 CAGACAAGGAGGGCCAGGCATGG - Intergenic
993095522 5:83474202-83474224 GAGAGAAGGCGGGCAGTGGGAGG + Intronic
993204779 5:84864508-84864530 AAGAGAGAGAGGGCCGGGCGTGG - Intergenic
993350430 5:86843507-86843529 AAGAGAATGTTGGCCGGGCGCGG + Intergenic
993978789 5:94516511-94516533 AAGAAAACGTGGGCCGGGCGCGG + Intronic
995171949 5:109124754-109124776 GATAGAAGTTGGGCCGGGCGCGG + Intronic
995925061 5:117362337-117362359 AAGAGAAGACTGGCCGGGCGCGG - Intergenic
996717936 5:126602235-126602257 CAGGGAAGCTGGGCCGGGCGCGG - Intronic
997288243 5:132699850-132699872 AAGAGGGAGCGGGCCGGGCGTGG - Intronic
997865652 5:137460465-137460487 CAGAGGAGGAGGGCAGGGAGCGG - Intronic
999413840 5:151377635-151377657 AAGAGACAGCAGGCCGGGCGCGG - Intergenic
999607506 5:153331857-153331879 CAGAGAGGGCCTGCCGGGCATGG - Intergenic
999904997 5:156131017-156131039 TACAGAATGCTGGCCGGGCGTGG - Intronic
1000826964 5:166057089-166057111 AAGAAAATGTGGGCCGGGCGCGG + Intergenic
1001421991 5:171594976-171594998 CCGTGTAGCCGGGCCGGGCGTGG + Intergenic
1001508279 5:172297646-172297668 AAAAAAAGGCAGGCCGGGCGCGG - Intergenic
1001653263 5:173329791-173329813 CAGAGGGCGCGGGCGGGGCGCGG - Intergenic
1001954412 5:175838546-175838568 GACAGAAGGGGGGCCGGGCGCGG - Intronic
1002159859 5:177308661-177308683 AAGAAATGGGGGGCCGGGCGCGG - Intronic
1002336716 5:178484531-178484553 CAGTGAGGCCGGGCCGGGCGTGG + Intronic
1002411198 5:179078089-179078111 AAGAGAAGACAGGCCGGGCGCGG - Intronic
1002498880 5:179634480-179634502 CGGAGGAGGCGGCCCTGGCGCGG - Intronic
1002502796 5:179658044-179658066 CGGAGGAGGCGGCCCTGGCGCGG + Intergenic
1002716291 5:181230201-181230223 CACACAGGGCCGGCCGGGCGCGG + Intronic
1002897447 6:1388036-1388058 CAGAGAGGGCGGGTGGGGAGGGG - Intergenic
1002898530 6:1392818-1392840 CAGGGAAGGCCGGCCGCGGGAGG - Intronic
1002954976 6:1853226-1853248 TATATAAGGAGGGCCGGGCGCGG + Intronic
1003044496 6:2720870-2720892 AAGAGAATGTGGGCTGGGCGTGG + Intronic
1003206564 6:4018447-4018469 CGGAGCAGCCGGGCCGGCCGAGG - Intergenic
1003251586 6:4433203-4433225 CCTAGAAAGGGGGCCGGGCGCGG - Intergenic
1003610628 6:7611732-7611754 CTTAGAAGACGGGCGGGGCGAGG - Exonic
1004605216 6:17188481-17188503 GAGATAAGGGCGGCCGGGCGCGG + Intergenic
1005393389 6:25356345-25356367 CTTAGAAGGAGGACCGGGCGCGG - Intronic
1005611236 6:27526900-27526922 TAGAAAAGGCAGGCCGGGCAGGG - Intergenic
1006144089 6:31947853-31947875 CAGAGAAGGGAGGCAGGGCAGGG + Intronic
1006177405 6:32130731-32130753 AAAAAAAGGTGGGCCGGGCGCGG + Intergenic
1006239539 6:32665226-32665248 CAAAGAAGGCGGGCAGAGCTGGG - Intronic
1006248683 6:32762113-32762135 CAGAGAGGGCGGGCAGGGCTGGG - Intronic
1006338847 6:33434812-33434834 AAGAGTAGGGGGGCCGGGCGCGG + Intronic
1006481372 6:34297220-34297242 AAGAAAAGGCAGGCCAGGCGCGG - Intronic
1006674298 6:35751200-35751222 CAGTGAATGAGGGCTGGGCGTGG - Intergenic
1007450815 6:41939616-41939638 CAGAGAGGGCGGGCCAGGGGAGG + Intronic
1007816015 6:44526093-44526115 CAGAGAAGGCTGGGCTGGGGTGG - Intergenic
1008184287 6:48371232-48371254 CAGGGGCGGCTGGCCGGGCGGGG + Intergenic
1008346395 6:50432677-50432699 CAGGGAAGGTTGGCCAGGCGTGG + Intergenic
1008841519 6:55909971-55909993 AAGGGACGGCTGGCCGGGCGGGG + Intergenic
1009167420 6:60357555-60357577 TACAAAAGGCAGGCCGGGCGTGG - Intergenic
1009964686 6:70566153-70566175 AAGAGAAAGTGGGCCGGGCAAGG - Intergenic
1010300593 6:74255082-74255104 CAGGGGCGGCTGGCCGGGCGGGG + Intergenic
1010427232 6:75741178-75741200 GAAAGTAGGCTGGCCGGGCGTGG - Intergenic
1012915176 6:105162439-105162461 CTAAAAATGCGGGCCGGGCGAGG + Intronic
1012947273 6:105480970-105480992 TAAAGAAGGCAGGCCTGGCGTGG + Intergenic
1013106130 6:107028151-107028173 CAGTGAGAGCGGGTCGGGCGGGG - Intergenic
1014098213 6:117482696-117482718 CAGAGGAGGCGGCCCGGCCCGGG + Exonic
1014436210 6:121423790-121423812 GAAAGAAGTCGGGCCGGGCAAGG + Intergenic
1015880579 6:137867062-137867084 CAGGGAAAGGGGGCGGGGCGGGG + Intergenic
1015930194 6:138351627-138351649 CATAGAAAGATGGCCGGGCGTGG + Intergenic
1017437168 6:154426643-154426665 AAGAAAAGACGGGCCGGGTGCGG - Intronic
1017632454 6:156410247-156410269 CATCAATGGCGGGCCGGGCGAGG + Intergenic
1017914037 6:158818597-158818619 GAGAGAGCGCCGGCCGGGCGGGG + Intronic
1018474048 6:164122716-164122738 AGGAGAAAGCTGGCCGGGCGCGG + Intergenic
1018678993 6:166247678-166247700 AAGAGAATGTGGTCCGGGCGCGG - Intergenic
1018683525 6:166284252-166284274 CAGAGACGCTGGGCCGGGTGAGG - Intergenic
1019168180 6:170112886-170112908 CAGAGAAGGTGGGATGGGAGTGG - Intergenic
1019274997 7:171536-171558 CAGACAAGGGGAGCCGGGAGGGG - Intergenic
1019472643 7:1229678-1229700 CAGAGGCCGCGGCCCGGGCGGGG + Intergenic
1019524174 7:1473306-1473328 CTCAGAGGGAGGGCCGGGCGGGG + Intronic
1019612563 7:1944389-1944411 TAGAAATGGCGGGCCGGGTGGGG + Intronic
1019757460 7:2783397-2783419 CAGAGAAGCAGGGCAGGGAGAGG - Intronic
1019984266 7:4643715-4643737 AAGAGAAGGTAGGCCGGGCGCGG + Intergenic
1020037234 7:4972020-4972042 CAAAGAAAACAGGCCGGGCGCGG + Intergenic
1020084335 7:5302573-5302595 CAGAGAAGGCAGGCAAGGCCTGG + Intronic
1020089981 7:5333439-5333461 GAGAGAAGGCGAGCGGGGCTTGG - Intronic
1020303215 7:6812196-6812218 CAGAATAGGCCGGCTGGGCGTGG + Intronic
1020585466 7:10060144-10060166 AAGAGAAGAACGGCCGGGCGCGG - Intergenic
1020735446 7:11943727-11943749 GAGAGACGGCGGGGCGGGGGAGG - Intergenic
1020776488 7:12460728-12460750 AAGAGAAAGAGGGCCGGGCACGG + Intergenic
1020870630 7:13624804-13624826 AAGAAAAGGGGGGCCGAGCGCGG + Intergenic
1021860426 7:24900675-24900697 CAGAGTTGGCTGGCCAGGCGTGG + Intronic
1022094569 7:27130619-27130641 CGCAGACGGCGGCCCGGGCGGGG - Exonic
1022462721 7:30626639-30626661 CAGGGAATGAGGGCCAGGCGTGG - Intronic
1023466992 7:40466911-40466933 CAGAACAGACGGGCCGGGCACGG + Intronic
1023972425 7:45000639-45000661 CAGAGGAAGTGGGCCCGGCGAGG + Intronic
1024325187 7:48103927-48103949 CAAAGATGGTTGGCCGGGCGCGG + Intronic
1024994099 7:55258091-55258113 TATAGAAAGCCGGCCGGGCGCGG - Intergenic
1025730191 7:64101517-64101539 CAGAGAAGTGGGACCGGGTGAGG + Intronic
1026008464 7:66618131-66618153 AAGAGCAGGGGGGCCCGGCGCGG - Intergenic
1026769105 7:73182572-73182594 CATAGAATGGGGGCCGGGCGCGG - Intergenic
1026813767 7:73492450-73492472 TAGAGCAGTCAGGCCGGGCGTGG - Intronic
1026860464 7:73783998-73784020 CAGAAAAAGAGGGCTGGGCGCGG - Intergenic
1026992153 7:74592821-74592843 CATTGAAGGCGGGCCGGGTACGG - Intronic
1026994994 7:74609890-74609912 GAGTTAAGGCAGGCCGGGCGTGG - Intergenic
1027009974 7:74735957-74735979 CATAGAATGGGGGCCGGGCGCGG - Intronic
1027025451 7:74848543-74848565 CAAAGAAGGCCTGCCGGGCGTGG + Intronic
1027062312 7:75095576-75095598 CAAAGAAGGCCTGCCGGGCGTGG - Intronic
1027078067 7:75210080-75210102 CATAGAATGGGGGCCGGGCGCGG + Intergenic
1027153625 7:75750827-75750849 GAGAGAAGGGGGGCTGGGTGTGG + Intergenic
1027198577 7:76048172-76048194 CAGCGCTGGCAGGCCGGGCGAGG - Exonic
1027373725 7:77533504-77533526 AAGGGACGGCTGGCCGGGCGGGG + Intergenic
1027543714 7:79500262-79500284 CAGAAAGGGAGGGCCGGGCGCGG - Intergenic
1027865292 7:83638819-83638841 CAGAGATTCCTGGCCGGGCGCGG + Intronic
1028020495 7:85765520-85765542 CAGTTAAGGCGGGGCGGGGGGGG - Intergenic
1028151934 7:87383785-87383807 AAGAAAATGTGGGCCGGGCGTGG - Intronic
1028774134 7:94658419-94658441 AAGAGGAGGCGGGCCTGGGGAGG - Intronic
1029194942 7:98798689-98798711 TGGAGAAGAGGGGCCGGGCGCGG - Intergenic
1029224851 7:99018163-99018185 TATAGAAGACGGGCCGGGCATGG - Intergenic
1029270417 7:99374222-99374244 GGGAGCAGGCGGTCCGGGCGTGG - Intronic
1029440348 7:100583788-100583810 CAGAGAAAGCGGGCAGGTGGAGG - Intronic
1030208038 7:106969577-106969599 GATGGAAGGTGGGCCGGGCGTGG + Intergenic
1030292150 7:107883490-107883512 GAGTGAGGGCGGGCCGGGCGCGG + Intergenic
1031908623 7:127489403-127489425 AAGAAAATGTGGGCCGGGCGTGG - Intergenic
1032171688 7:129589769-129589791 AAGAAAAGACTGGCCGGGCGCGG - Intergenic
1032254280 7:130284657-130284679 AAAAGGAGGCAGGCCGGGCGCGG + Intronic
1032937303 7:136747756-136747778 AAGAAAAGGGAGGCCGGGCGCGG + Intergenic
1033057518 7:138072846-138072868 AAGAAAAGGTGGGCCAGGCGTGG + Intronic
1033176189 7:139126026-139126048 TAGAAAATGCTGGCCGGGCGCGG + Intergenic
1033203132 7:139391875-139391897 CAATGAAGCCAGGCCGGGCGTGG - Intronic
1033437609 7:141347713-141347735 CAGAGAAGGCAGACGGGGGGTGG - Intronic
1033454307 7:141488726-141488748 AAGAAAATGCAGGCCGGGCGCGG - Intergenic
1033989074 7:147262512-147262534 CAGGGAGGCCGGGCCTGGCGCGG + Intronic
1034095716 7:148405940-148405962 TAAAGAAGGTCGGCCGGGCGCGG + Intronic
1034166523 7:149028805-149028827 CAAAGGCGGCGGGCCGGGCACGG + Intergenic
1034306679 7:150049185-150049207 AAGAGAAGCCAGGCCGGGCCTGG - Intergenic
1034800166 7:154051458-154051480 AAGAGAAGCCAGGCCGGGCCTGG + Intronic
1035064130 7:156093003-156093025 AAGAAAATGCTGGCCGGGCGCGG - Intergenic
1035307562 7:157943021-157943043 CACAGCAGGAGGGCCGGGCCTGG + Intronic
1035781742 8:2233297-2233319 CAGAGCACACAGGCCGGGCGTGG + Intergenic
1035810349 8:2486017-2486039 CAGAGCACACAGGCCGGGCGTGG - Intergenic
1035810355 8:2486063-2486085 CAGAGCACACAGGCCGGGCGTGG - Intergenic
1036213296 8:6859986-6860008 AAGAGAACCTGGGCCGGGCGCGG - Intergenic
1036800649 8:11788645-11788667 CAAAGAATGTGGGCCAGGCGTGG + Intergenic
1036848247 8:12184499-12184521 CACAGGAGGCTGGCCGGGCGCGG - Intronic
1036850609 8:12198274-12198296 AAGAGAATGAGGGCCGGGCGTGG + Intergenic
1036869609 8:12426780-12426802 CACAGGAGGCTGGCCGGGCGCGG - Intronic
1036871974 8:12440539-12440561 AAGAGAATGAGGGCCGGGCGTGG + Intergenic
1037633493 8:20679041-20679063 AAGAGAGGTGGGGCCGGGCGTGG - Intergenic
1037653092 8:20858324-20858346 AAAAGAAGCCTGGCCGGGCGCGG - Intergenic
1037785906 8:21903103-21903125 CAGAGATGGCTGGTCGGGGGCGG - Intergenic
1037856517 8:22375034-22375056 AAGAGCAGGCTGGCCAGGCGCGG - Intronic
1038304112 8:26383517-26383539 CAGCGGAGCCGGGCGGGGCGGGG + Intronic
1038364655 8:26918922-26918944 AAGGAAAGGCAGGCCGGGCGTGG + Intergenic
1038505285 8:28079249-28079271 TAAAGAATGCGGGCCGGGTGCGG + Intronic
1038768693 8:30455597-30455619 GAGACAATGCAGGCCGGGCGTGG + Intronic
1039238092 8:35525095-35525117 CAGCGGAGGCAGGCCGGGGGAGG - Intronic
1039560361 8:38507819-38507841 AAGAGAAGAGGAGCCGGGCGCGG - Intergenic
1039842521 8:41304094-41304116 CAGGGCAGGCGGGCGGGGTGGGG + Intronic
1040027215 8:42792814-42792836 AAGGGAAGGTGGGCCAGGCGCGG + Intronic
1040031928 8:42832658-42832680 CAGAGAGCTCTGGCCGGGCGTGG - Intergenic
1040065566 8:43141193-43141215 CGGAGAAGGCGGTGGGGGCGCGG + Intronic
1041405839 8:57498257-57498279 CAAAAAAGGGGGGCCGGGCGTGG - Intergenic
1042010139 8:64235065-64235087 AAGAAAACGGGGGCCGGGCGCGG + Intergenic
1042306285 8:67336838-67336860 CTGACAAGGCAGGCCGGGCGCGG + Intronic
1042629569 8:70802224-70802246 AAGAAAAGAAGGGCCGGGCGCGG - Intergenic
1043116325 8:76258423-76258445 CACAAAAGGCTGGCCGGGTGCGG + Intergenic
1043536920 8:81215269-81215291 TAGAGCACGTGGGCCGGGCGAGG + Intergenic
1043847745 8:85180867-85180889 CAAACAAGACCGGCCGGGCGCGG - Intronic
1044841978 8:96344650-96344672 AAGAGAATTTGGGCCGGGCGTGG - Intergenic
1045343456 8:101274102-101274124 CAGTGAAGATGGGCCGGGCATGG - Intergenic
1045389845 8:101704624-101704646 AAGTGAATGGGGGCCGGGCGCGG + Intronic
1046377051 8:113397528-113397550 CAAAGACTGTGGGCCGGGCGCGG + Intronic
1047210037 8:122833704-122833726 AAGAGTGAGCGGGCCGGGCGCGG + Intronic
1047316750 8:123741669-123741691 TGGAGAATGTGGGCCGGGCGTGG + Intergenic
1047459765 8:125051595-125051617 AAAGGAAGGAGGGCCGGGCGTGG + Intronic
1047704850 8:127487703-127487725 CAGTGAATTAGGGCCGGGCGCGG - Intergenic
1048350436 8:133611567-133611589 GAAAGGAGGTGGGCCGGGCGCGG + Intergenic
1049120000 8:140727903-140727925 TAGAGAAAGACGGCCGGGCGCGG + Intronic
1049177786 8:141205167-141205189 ATGTGAAGACGGGCCGGGCGCGG + Intergenic
1049405070 8:142448775-142448797 CAGAGAGTGGGGGCTGGGCGGGG - Intergenic
1049420676 8:142515185-142515207 CAGGGAAGGCGTGCAGGGCAGGG + Intronic
1049463990 8:142742822-142742844 CAGGGAAGGGGTGCCAGGCGGGG - Intergenic
1049465835 8:142750935-142750957 CACGGAAGGCGGGCAGGGCTGGG - Intronic
1049465857 8:142751019-142751041 CACAGAAGGCGGGCAGGGCCGGG - Intronic
1049549064 8:143248106-143248128 CAGAGTGGACTGGCCGGGCGCGG - Intronic
1049613692 8:143567345-143567367 CGGAGAAGGCGGGGCCCGCGGGG + Exonic
1049646179 8:143736794-143736816 CAGTGAAGGCGGGGCTGGGGTGG - Intergenic
1049662118 8:143824210-143824232 CAGAGAGGGCTGGCTGGGGGCGG - Intronic
1049762298 8:144336953-144336975 CAGGGAGGGCGGGCCGAGGGAGG + Intergenic
1049899650 9:146883-146905 CACAGAGGACAGGCCGGGCGCGG + Intronic
1050437884 9:5629053-5629075 CAGAGAGGGCGGGAGGAGCGCGG - Intronic
1050472558 9:6008083-6008105 AAGAGCAGGCGGGCGGGGTGCGG - Intergenic
1050815935 9:9811415-9811437 CAAAGAAAGTGGGCCAGGCGCGG + Intronic
1051130146 9:13851523-13851545 CACAGTGTGCGGGCCGGGCGCGG + Intergenic
1051712727 9:19948565-19948587 CAGAGCTAACGGGCCGGGCGCGG + Intergenic
1051720765 9:20034756-20034778 CTTAAAAGGCAGGCCGGGCGCGG - Intergenic
1052943424 9:34148346-34148368 AAAAAAAGGCAGGCCGGGCGTGG + Intergenic
1055003954 9:71484434-71484456 AAGAGAAACCTGGCCGGGCGCGG - Intergenic
1055054861 9:72014343-72014365 AAGAGAGGGAGGGCCGGGTGCGG + Intergenic
1055294673 9:74821811-74821833 AAGACAAGGCGTGCCGGTCGTGG - Exonic
1056649337 9:88444531-88444553 AACAGAATGGGGGCCGGGCGCGG - Intronic
1056954382 9:91070828-91070850 AAGAGAATGCAGGCCGGGTGCGG - Intergenic
1057394818 9:94670488-94670510 TAGAGATGGGGGGCTGGGCGCGG + Intergenic
1057502171 9:95604505-95604527 AAGAAAATGTGGGCCGGGCGTGG - Intergenic
1057503057 9:95611064-95611086 AAGGGAGGGCGGGCTGGGCGAGG - Intergenic
1057533142 9:95873019-95873041 CAGAAAATGAGGGCCGGGCGCGG + Intergenic
1058157893 9:101535195-101535217 AAGTCAAGGCGGGCCGGGCGCGG - Intronic
1059633188 9:116147016-116147038 CACAGAGGGTAGGCCGGGCGCGG + Intergenic
1059709530 9:116854940-116854962 ATGAGAAGGGAGGCCGGGCGCGG - Intronic
1060139915 9:121201327-121201349 CCGAGAAGGCGGGGAAGGCGAGG + Intronic
1060175743 9:121496438-121496460 AATAGAAGGTAGGCCGGGCGTGG + Intergenic
1060475762 9:123985361-123985383 AAGAGAAGTGGGGCCGGGTGCGG - Intergenic
1060522682 9:124302655-124302677 CAGAGAGGGCGTGCCAGGCCCGG - Intronic
1060563320 9:124566816-124566838 AAGAGAGGACAGGCCGGGCGCGG + Intronic
1060742469 9:126108591-126108613 CAGAGAGGGGCGGCGGGGCGGGG - Intergenic
1060756805 9:126219718-126219740 CGGAGAAGGGGGGCAGGGAGGGG - Intergenic
1061316974 9:129802541-129802563 AAAAAAAGGCTGGCCGGGCGCGG - Intergenic
1061988840 9:134146524-134146546 TAGATAAGGGAGGCCGGGCGCGG - Intronic
1062048535 9:134435469-134435491 CAGAGAAGGCTGGCCGGGGAGGG - Intronic
1062211679 9:135367779-135367801 ATGAAAAGACGGGCCGGGCGCGG + Intergenic
1062314761 9:135961214-135961236 CCGGGAAGGCGGGCGGGGAGGGG + Exonic
1062341294 9:136094964-136094986 CCGCGGAGGGGGGCCGGGCGGGG - Intronic
1062350384 9:136135835-136135857 CACAGCAGGCGGGCTGGGCAGGG - Intergenic
1062565549 9:137162523-137162545 GGGACCAGGCGGGCCGGGCGGGG - Intronic
1185456648 X:314130-314152 CAGGTAACTCGGGCCGGGCGCGG - Exonic
1185646877 X:1622280-1622302 CAGAGACAGAGGACCGGGCGTGG - Intronic
1185854252 X:3519586-3519608 CAGAGAATGGTGGCCGGGTGTGG - Intergenic
1186650976 X:11559635-11559657 TAAAGTAGGAGGGCCGGGCGCGG + Intronic
1187466338 X:19531063-19531085 CAGAGATGTCTGGCCAGGCGAGG - Intergenic
1188205061 X:27345831-27345853 AAGAAAATGTGGGCCGGGCGTGG + Intergenic
1188452208 X:30319536-30319558 CCTGGAAGGCGGGCGGGGCGGGG - Intergenic
1188799823 X:34515725-34515747 AAGAAAATGTGGGCCGGGCGCGG + Intergenic
1189274938 X:39778731-39778753 CAGAGAAGGCAGGCCAGGGCTGG + Intergenic
1189344941 X:40233565-40233587 CAGATGAGGTTGGCCGGGCGCGG + Intergenic
1189348495 X:40260207-40260229 CAGAGGAGGCGGGGCGGGGGAGG - Intergenic
1189818559 X:44847811-44847833 GAGTCAAGGAGGGCCGGGCGCGG - Intergenic
1190907526 X:54742161-54742183 AAGAGAAGTCCGGCCAGGCGTGG - Intergenic
1191773342 X:64785792-64785814 AAGACAAGGGGGGCCGGGCGCGG - Intergenic
1192340397 X:70259158-70259180 CAGAGAAGGCCTGCGAGGCGAGG + Exonic
1192448389 X:71227099-71227121 TAGAGATGGGAGGCCGGGCGCGG - Intergenic
1194205478 X:91006139-91006161 GAGAGAAAATGGGCCGGGCGCGG - Intergenic
1195279960 X:103322510-103322532 CCAAGCAGGAGGGCCGGGCGTGG - Intergenic
1196788539 X:119443409-119443431 TAGAGAATGGGGGCTGGGCGCGG - Intronic
1196979421 X:121195386-121195408 AATAGAAGAAGGGCCGGGCGCGG + Intergenic
1196984761 X:121256051-121256073 CAGAGAATGCAGGCTGGGCTCGG - Intergenic
1197225542 X:123952815-123952837 AAGATAGAGCGGGCCGGGCGCGG + Intergenic
1197606329 X:128589911-128589933 CAGACAAGGCAGGCCGGGTGCGG + Intergenic
1198767145 X:140091495-140091517 CTGAGCCGGCGGGCGGGGCGGGG + Intergenic
1200883988 Y:8251567-8251589 AAGAGAAGGCAGCCAGGGCGTGG + Intergenic