ID: 1168758824

View in Genome Browser
Species Human (GRCh38)
Location 20:334639-334661
Sequence AAGAGTGAGAAGGACCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168758818_1168758824 18 Left 1168758818 20:334598-334620 CCAGCTTGCGGGGAAGGTGTGGA No data
Right 1168758824 20:334639-334661 AAGAGTGAGAAGGACCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168758824 Original CRISPR AAGAGTGAGAAGGACCTTGA AGG Intergenic
No off target data available for this crispr