ID: 1168759566

View in Genome Browser
Species Human (GRCh38)
Location 20:340558-340580
Sequence TGGATTATCTATTAAGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168759566_1168759568 11 Left 1168759566 20:340558-340580 CCTATTTCTTAATAGATAATCCA No data
Right 1168759568 20:340592-340614 TCAAAAGTAGACAGTTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168759566 Original CRISPR TGGATTATCTATTAAGAAAT AGG (reversed) Intergenic
No off target data available for this crispr