ID: 1168759567

View in Genome Browser
Species Human (GRCh38)
Location 20:340578-340600
Sequence TACTTTTGAGAAAAACAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168759567_1168759568 -9 Left 1168759567 20:340578-340600 CCATCTTGTTTTTCTCAAAAGTA No data
Right 1168759568 20:340592-340614 TCAAAAGTAGACAGTTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168759567 Original CRISPR TACTTTTGAGAAAAACAAGA TGG (reversed) Intergenic
No off target data available for this crispr