ID: 1168759568

View in Genome Browser
Species Human (GRCh38)
Location 20:340592-340614
Sequence TCAAAAGTAGACAGTTTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168759567_1168759568 -9 Left 1168759567 20:340578-340600 CCATCTTGTTTTTCTCAAAAGTA No data
Right 1168759568 20:340592-340614 TCAAAAGTAGACAGTTTATCAGG No data
1168759566_1168759568 11 Left 1168759566 20:340558-340580 CCTATTTCTTAATAGATAATCCA No data
Right 1168759568 20:340592-340614 TCAAAAGTAGACAGTTTATCAGG No data
1168759564_1168759568 30 Left 1168759564 20:340539-340561 CCATGCCTGGACAAATTTTCCTA No data
Right 1168759568 20:340592-340614 TCAAAAGTAGACAGTTTATCAGG No data
1168759565_1168759568 25 Left 1168759565 20:340544-340566 CCTGGACAAATTTTCCTATTTCT No data
Right 1168759568 20:340592-340614 TCAAAAGTAGACAGTTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168759568 Original CRISPR TCAAAAGTAGACAGTTTATC AGG Intergenic
No off target data available for this crispr