ID: 1168760720

View in Genome Browser
Species Human (GRCh38)
Location 20:347856-347878
Sequence CCCGGGACGAGGGTTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168760720 Original CRISPR CCCGGGACGAGGGTTGCCAT GGG (reversed) Intronic
900308197 1:2021113-2021135 CCCTGGAAGAGGGGTGCCGTTGG + Intronic
901783544 1:11609990-11610012 CCCAGGATGAGGGAAGCCATGGG - Intergenic
905469719 1:38182767-38182789 CAGGGGACAAGGGTTGTCATGGG - Intergenic
1063652337 10:7950287-7950309 CCAGGGAAGAGTGTTCCCATGGG + Intronic
1067478890 10:46582933-46582955 GCTGGGAAGAGGGGTGCCATCGG + Intronic
1067615848 10:47758868-47758890 GCTGGGAAGAGGGGTGCCATCGG - Intergenic
1076234395 10:128852526-128852548 CCTGGGAAGTGGATTGCCATGGG + Intergenic
1076948343 10:133666087-133666109 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076949332 10:133669397-133669419 ACCGGGACTCGGGTTGCCGTCGG + Intronic
1076950316 10:133672696-133672718 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076951301 10:133675995-133676017 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076952291 10:133679305-133679327 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076953279 10:133682615-133682637 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076955247 10:133742266-133742288 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076956237 10:133745576-133745598 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076957225 10:133748885-133748907 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076958214 10:133752195-133752217 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076959198 10:133755494-133755516 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076960187 10:133758804-133758826 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1078432850 11:11301060-11301082 GCAGGGACGAGGGTATCCATAGG + Intronic
1083674600 11:64318427-64318449 AGCGGGACGGGGATTGCCATGGG - Intronic
1085522093 11:77144909-77144931 CCAGGGACCAGGGATGCCTTTGG - Intronic
1089553251 11:119298379-119298401 CTCGGGACCAGTGTTGGCATGGG - Exonic
1089824656 11:121264455-121264477 CCTGAGACGAGAGTGGCCATAGG - Intergenic
1096070538 12:48773276-48773298 CCCAGGACTAGGGTTTCCTTGGG + Intronic
1096111938 12:49034008-49034030 GCAGGGAAGAGGGTTGGCATGGG - Intronic
1101527507 12:105544867-105544889 CCAAGGCCAAGGGTTGCCATCGG + Intergenic
1113925966 13:113941808-113941830 CCCTGGACGAGGTCTGCCCTAGG + Intergenic
1119423908 14:74523923-74523945 CCCGGGGAGAGGGTAGCCTTGGG - Intronic
1122577397 14:102750916-102750938 CCAGGGTTGAGGGTTGCCTTGGG + Intergenic
1129456814 15:75680500-75680522 CCCAGGACTAGAGTTGCCAGTGG + Intronic
1144835585 17:18155048-18155070 CCCGAGATGGGGGTTGCCAGGGG + Intronic
1145254687 17:21316174-21316196 CCCAGGAGGAGGGTCCCCATGGG + Intergenic
1145321910 17:21771791-21771813 CCCAGGAGGAGGGTCCCCATGGG - Intergenic
1146182778 17:30708456-30708478 CCCGGGACCTGGGTTCGCATGGG - Intergenic
1160622350 18:80180139-80180161 CCCGGGACGGGAATGGCCATTGG + Intronic
1164547831 19:29183854-29183876 CCCGGGACTGGGGATGCCAGTGG - Intergenic
927697458 2:25247812-25247834 CCCAGGGCTGGGGTTGCCATGGG - Intronic
939998838 2:148947392-148947414 CCAGGAACGAGCTTTGCCATTGG + Intronic
942188383 2:173446380-173446402 CCTGGGACAGGAGTTGCCATGGG - Intergenic
946079918 2:217108963-217108985 CCCTTGACCAGGGTAGCCATGGG - Intergenic
948830039 2:240594223-240594245 CCTGGGACCAAGGTGGCCATTGG + Intronic
1168760720 20:347856-347878 CCCGGGACGAGGGTTGCCATGGG - Intronic
1169947208 20:11002070-11002092 GCCGGGACGAGGGTGGCTCTTGG - Intergenic
1172245617 20:33443465-33443487 CTCGGGACCAGGGTCGCCGTCGG + Exonic
1180040818 21:45278689-45278711 CCTGGGACTAGGTTTGCCACCGG - Intronic
1180100102 21:45579872-45579894 CCCGGGATGCGGGTGGCCCTGGG + Intergenic
1182358036 22:29731063-29731085 CCCAGGACGAGGGCTGCACTTGG + Exonic
1184192323 22:42903149-42903171 CCTGGGACGTGGGTTGGCTTAGG - Intronic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1185125192 22:49006707-49006729 CCCTGGAGCAGGGTTGACATGGG - Intergenic
951178484 3:19630650-19630672 CGGGGGAAGAGGGTTGCCACTGG - Intergenic
968812605 4:2806718-2806740 ACCTGGAAGAGGGTTGCCCTAGG - Intronic
969402897 4:6968707-6968729 GCCGGGAGGAGGCTGGCCATGGG + Intronic
971687449 4:29787431-29787453 CCCAGGAAGAAGTTTGCCATAGG - Intergenic
972704219 4:41525854-41525876 CCAGGGTCCAGAGTTGCCATAGG - Intronic
985451797 4:190066891-190066913 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
985452785 4:190070183-190070205 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
985453771 4:190073476-190073498 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
985454760 4:190076769-190076791 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
985455750 4:190080066-190080088 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
985456733 4:190083360-190083382 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
985457720 4:190086656-190086678 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
985458708 4:190089953-190089975 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
993686284 5:90942376-90942398 CCCTGGAAGAGGGGTCCCATTGG + Intronic
997295236 5:132764778-132764800 CCTGGGACCAGGGTGGTCATGGG + Intronic
1001105075 5:168845999-168846021 CCCTGGAAGAGGGTTCCCAAAGG - Intronic
1022914157 7:34930025-34930047 CCCGGGACCAGGCCTGCCCTTGG + Exonic
1039386789 8:37143175-37143197 CCCAGGATGAGGGATGCCACTGG + Intergenic
1045322507 8:101092480-101092502 CCAGGGAAGTTGGTTGCCATTGG + Intergenic
1058073170 9:100622424-100622446 CCAGGGACGAGGGTTGCTTGAGG + Intergenic
1060989129 9:127838322-127838344 CCCTGGGAGAGGGCTGCCATTGG + Intronic
1061262550 9:129488247-129488269 CCCGGGAAGAGGGGTGCGGTGGG + Intergenic
1061907065 9:133704225-133704247 CCTGGGCTGTGGGTTGCCATGGG + Intronic
1188972598 X:36636123-36636145 GACGGGATGTGGGTTGCCATTGG - Intergenic
1199116657 X:144000300-144000322 CCCAGGCAGAGGATTGCCATAGG - Intergenic