ID: 1168765376

View in Genome Browser
Species Human (GRCh38)
Location 20:378666-378688
Sequence TCCTCTAGGCAGAGGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168765376_1168765380 19 Left 1168765376 20:378666-378688 CCATCCAGCCTCTGCCTAGAGGA 0: 1
1: 0
2: 0
3: 24
4: 281
Right 1168765380 20:378708-378730 CTTTTTTTTTTTTTTTGAGACGG 0: 7194
1: 95351
2: 66312
3: 83357
4: 126880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168765376 Original CRISPR TCCTCTAGGCAGAGGCTGGA TGG (reversed) Intronic
900142693 1:1145234-1145256 CTCTCGGGGCAGAGGCTGGATGG - Intergenic
900702892 1:4058975-4058997 TGCTCTGGTTAGAGGCTGGATGG + Intergenic
900766909 1:4511978-4512000 TCCTCCAGTGTGAGGCTGGAGGG + Intergenic
900783293 1:4631700-4631722 ACCTCTGAGCAGAGGCTTGATGG - Intergenic
901199501 1:7458558-7458580 TCCTCTGGGCAGGGGCGGGAAGG - Intronic
902876560 1:19344019-19344041 TCCCCTAGGCCCAGGCTGGAGGG + Intronic
903383870 1:22914369-22914391 TCCTCGAGGCAGGGGCTGGCGGG - Intronic
903817546 1:26075779-26075801 TGCTCCAAGCAGAGGCTTGAGGG - Intergenic
903861507 1:26367544-26367566 TGCGCCTGGCAGAGGCTGGAGGG - Intronic
903872606 1:26447460-26447482 TTTTCTAGGGAAAGGCTGGAAGG + Intronic
904663765 1:32104386-32104408 TCCTATGGGCATAGGATGGAGGG + Intergenic
905871817 1:41408672-41408694 TCCTGTAAGAAGAGCCTGGAAGG - Intergenic
906156147 1:43615213-43615235 CCCTATAGGCAGAGGCAGCACGG - Intronic
906424978 1:45704111-45704133 TCACCTAGGCAGTGACTGGATGG + Intronic
907459133 1:54594759-54594781 CCCACTGGGCAGAGGCAGGAAGG + Intronic
908756511 1:67473790-67473812 TCTTTTAGGCAGAGGCAGAAAGG - Intergenic
910011716 1:82471871-82471893 TCCCCTCCGCAGAGGTTGGAAGG + Intergenic
911011598 1:93287130-93287152 ATCTCCAGGCAGAGGCTGCATGG + Intergenic
912335656 1:108859950-108859972 TCCTTTAGGCAGGGGGAGGAGGG - Intronic
912843169 1:113057345-113057367 TGATCTAGGCAGAGGCATGAGGG - Intergenic
913248509 1:116891762-116891784 TCCTCATACCAGAGGCTGGATGG + Intergenic
914769504 1:150671164-150671186 TCCAGGAGGCAGAGGCTGCAGGG + Intronic
914912283 1:151797278-151797300 TCCCTGAGGCAGAGGCTGTAAGG + Intergenic
915103970 1:153520904-153520926 TCCTCTAGGCAGAGGTAGCCAGG + Intergenic
915589562 1:156862799-156862821 CCCTCTGGGCAGGGGCTGGGGGG + Intronic
915690629 1:157686070-157686092 TACTCTTGGCAGAGTCTTGAGGG - Intronic
916602340 1:166305341-166305363 ACCTTTCAGCAGAGGCTGGAAGG + Intergenic
916786367 1:168089900-168089922 TCCTTTAGGCAGAGGCTAAAGGG + Intronic
917740754 1:177960077-177960099 TCCATTATGCAGAGGCTGCATGG - Intronic
918615136 1:186535524-186535546 TGCTCTAGGCTGGGCCTGGAAGG + Intergenic
919902469 1:202054467-202054489 TCCTTGAGGGGGAGGCTGGAAGG + Intergenic
920225204 1:204433551-204433573 TGCTGTGGGCAGTGGCTGGAGGG + Intronic
922182769 1:223248359-223248381 TCCTGCAGGCAGAGGTTGGGTGG - Intronic
924611418 1:245576797-245576819 TCCACTTAGGAGAGGCTGGAGGG - Intronic
1062845375 10:699255-699277 TCATGGAGTCAGAGGCTGGAGGG - Intergenic
1062860979 10:809125-809147 TGCACTAGGAAGAGGCTGGCGGG - Exonic
1062989931 10:1805863-1805885 GCCTCTGGGGAGAGACTGGAAGG + Intergenic
1063902196 10:10745689-10745711 TCCATTAGGCAGAGACTGGCAGG - Intergenic
1071430390 10:85602318-85602340 GCCTCCAGGCACGGGCTGGAAGG + Exonic
1071991312 10:91103138-91103160 GCCCCAAGGCAGAGGGTGGAGGG + Intergenic
1072691024 10:97572512-97572534 TGCTCAGGACAGAGGCTGGACGG + Exonic
1073516629 10:104081733-104081755 GGCACTAGGCAGAGACTGGAAGG - Intronic
1075095614 10:119468899-119468921 TACCCAAGGCAGAGCCTGGAAGG + Intergenic
1076316585 10:129546289-129546311 TCCTCAAGACAGCGGCTGGCAGG + Intronic
1076359324 10:129875809-129875831 TCCTCCAGGCAGAGGCTGCCAGG - Intronic
1077216043 11:1395541-1395563 TCCCCTAGGCGGGGGCGGGAGGG + Intronic
1077328629 11:1974299-1974321 TCCTCTGGGTTGAGGCTGGAGGG + Intronic
1077470709 11:2759232-2759254 TGCTCAAGGAAGAGTCTGGAAGG + Intronic
1077613753 11:3660667-3660689 TCTCCTGGTCAGAGGCTGGAAGG + Intronic
1078923081 11:15849466-15849488 TGCTCTGAGCAGAGGCGGGAGGG - Intergenic
1080715700 11:34797794-34797816 TCCACTAGGCAGAGTCTGTAAGG - Intergenic
1081708335 11:45199827-45199849 TGCCCTAGGCAGAGGGTGCAGGG - Intronic
1081827426 11:46070404-46070426 CCCTGGAGGCAGAGGCTGCAGGG - Intronic
1082179696 11:49102642-49102664 TTCTCTGGGCGGAGGCTTGAGGG + Intergenic
1083616090 11:64027362-64027384 TCCTGGAGGCAGGGGCTGCAGGG + Intronic
1085417324 11:76328071-76328093 GGCTCTGGGCAGAGGCTGGCGGG + Intergenic
1086048567 11:82561953-82561975 TCCTGTAGGCAGATACTGCAAGG - Intergenic
1086133512 11:83423877-83423899 TCCTACAGCCAGAGGCTGCATGG - Intergenic
1086324314 11:85682745-85682767 TCCCATGGGCAGAGGCCGGACGG - Intronic
1086685586 11:89730270-89730292 TTCTCTGGGCGGAGGCTTGAGGG - Intergenic
1087487411 11:98773135-98773157 TCGCCTATGCAGAGGCTGCAAGG + Intergenic
1087981838 11:104623850-104623872 TCTTTTAGACTGAGGCTGGATGG - Intergenic
1088178708 11:107083955-107083977 TCCCTTAAGCAGAGGATGGAGGG - Intergenic
1088781536 11:113138934-113138956 TATGCTAGGCAGAGACTGGAGGG - Intronic
1089283577 11:117391457-117391479 TCCTCCAGGGTCAGGCTGGATGG + Intronic
1090751347 11:129748966-129748988 TCATCTATGAAGAGGCAGGAAGG - Intergenic
1202811608 11_KI270721v1_random:29478-29500 TCCTCTGGGTTGAGGCTGGAGGG + Intergenic
1091699207 12:2648919-2648941 TGCTCTAGGCAGGAGATGGAAGG + Intronic
1092258655 12:6940872-6940894 GCACCGAGGCAGAGGCTGGAGGG - Exonic
1092748458 12:11695526-11695548 TCCTAATGGCACAGGCTGGAGGG + Intronic
1094435974 12:30421197-30421219 ACCAAGAGGCAGAGGCTGGAGGG - Intergenic
1096846834 12:54412041-54412063 GCCTCTAGGCTGGGGCTGGCTGG + Intronic
1097153304 12:56995118-56995140 TCCTCAAGGTAGAGGCCAGAGGG - Intronic
1097507467 12:60494066-60494088 TTATCTAGGCAGAGGCTGGTGGG + Intergenic
1097959952 12:65522542-65522564 TCGACTGGGCAGAAGCTGGAAGG + Intergenic
1098487777 12:71041486-71041508 TGCTGGAGGCAGAGGCTGGTGGG - Intergenic
1103210528 12:119162832-119162854 TGCTCCAGGCAGAGGCTGTCTGG - Exonic
1103564909 12:121810635-121810657 TCCTCCAGGCCGGTGCTGGAGGG - Exonic
1104912992 12:132248863-132248885 TCCCCTGGGAAGAGGCTGCATGG + Intronic
1106117424 13:26829642-26829664 TCCTGCAGGCAGATGGTGGAGGG + Intergenic
1106226520 13:27790668-27790690 TCCGCTGGGCAGAGGCAGGCTGG - Intergenic
1106476460 13:30102466-30102488 TCTTTTAGGCAGAATCTGGAAGG - Intergenic
1107164249 13:37266485-37266507 TTCTCTAGGCAAAAACTGGATGG + Intergenic
1107652814 13:42561653-42561675 TCCTCTGGGCTGAGGTTTGAAGG + Intergenic
1112214425 13:97415521-97415543 TCAGCTAAGCAGAGGCTGGTGGG + Intergenic
1114539916 14:23447439-23447461 TTCTCATTGCAGAGGCTGGAAGG - Intergenic
1118980418 14:70711756-70711778 GCCTCTTGACAGAAGCTGGAGGG - Intergenic
1119389518 14:74281528-74281550 GCCTCTGGGCAGAGGAAGGAGGG - Intergenic
1121127320 14:91416904-91416926 TCTCCCAGGCAGAGACTGGACGG + Intronic
1121683571 14:95814844-95814866 TTGTCTTGGCAGAGGCAGGAGGG - Intergenic
1121999049 14:98630931-98630953 GCCTCCAGTCAGAGGGTGGAGGG - Intergenic
1122045476 14:99020202-99020224 TCCTCGAGGGAGAGGATGGGTGG - Intergenic
1124550874 15:30680412-30680434 TCCACTGGGCAGAGGCTGTGAGG + Intronic
1124680288 15:31724735-31724757 TCCTTCAGGTAAAGGCTGGATGG - Intronic
1124680378 15:31725255-31725277 TCCACTGGGCAGAGGCTGTGAGG - Intronic
1125892345 15:43276050-43276072 GCCTGCAGGCAGAGGATGGAGGG - Intergenic
1127871317 15:63076251-63076273 TCCTCTTGGCGGATGCTGCATGG + Intergenic
1128625092 15:69193203-69193225 ACCTCCAGGCAGAAGCTGGAGGG + Intronic
1129148375 15:73670533-73670555 TCCTCTAGGCAAAGGTATGAGGG + Intergenic
1129935865 15:79449864-79449886 TACTCTAGGCAGAGGGCAGAAGG - Intronic
1130897655 15:88183542-88183564 TGCTCTGGGCTGAGGCTGGCAGG + Intronic
1132461530 16:57716-57738 CCCTAAAGGCTGAGGCTGGAGGG - Intergenic
1132514949 16:361908-361930 TCCTCTCAGCAGGGGCTGCAAGG - Intergenic
1132524448 16:407372-407394 TTCTCCAGGCCGAGGCTGCAGGG + Intronic
1132598482 16:763713-763735 TCCTCAAGGGTGAGGCTCGAGGG + Intronic
1132688802 16:1173180-1173202 TCCAAAAGGCCGAGGCTGGAAGG + Intronic
1133053896 16:3135196-3135218 GCCCCGAGGCAGAGGCCGGAGGG + Exonic
1133537142 16:6713192-6713214 GGCTCTAGGCAGAAGATGGATGG - Intronic
1133732018 16:8586157-8586179 ACCTCTAGAAGGAGGCTGGAAGG + Intronic
1134142799 16:11736437-11736459 TCCCCTAGGTGTAGGCTGGAAGG + Intronic
1134823447 16:17265335-17265357 TCCTCTAGGCAGAGACTGTCAGG - Intronic
1136022638 16:27449753-27449775 TCCTGGAGGCAGACGCTGGAGGG - Exonic
1137902245 16:52281262-52281284 TGCACTAGCCAGAGGCTGGAGGG + Intergenic
1139106720 16:63835372-63835394 TGATCTATGCAGAGCCTGGAGGG + Intergenic
1139310934 16:66027431-66027453 TCCTCCAGGCAAAGGCAAGAAGG + Intergenic
1139802584 16:69535609-69535631 TCCTCTTGGCATAGGATAGAGGG + Intergenic
1140251719 16:73300387-73300409 TCCTCTAGGTAGAGTCCAGAGGG - Intergenic
1142871910 17:2826623-2826645 TCCTCTTGGCTGGGGTTGGAGGG + Intronic
1143136280 17:4714470-4714492 TCCTCTGGGAAGAGCCTGGGTGG + Intronic
1144452552 17:15393115-15393137 TCCTCCAGGCAGAGCCTGTGGGG - Intergenic
1146501731 17:33370481-33370503 TCCTGCAAGCAAAGGCTGGAGGG + Intronic
1147031749 17:37643514-37643536 TCCTGTAGGCGGAGCCTGGCTGG + Intergenic
1147910428 17:43852942-43852964 TGTTGTAGCCAGAGGCTGGAAGG - Exonic
1148161368 17:45452021-45452043 TCCTGTTGGCACAGACTGGAGGG - Intronic
1148218432 17:45846536-45846558 GGCTCTAGGCAGAAGCAGGAGGG + Exonic
1148989409 17:51652544-51652566 TGCACTGGGCAGGGGCTGGATGG - Intronic
1149935310 17:60799602-60799624 TCCAGGAGGCAGAGGCTGCAGGG - Intronic
1150137568 17:62704085-62704107 TCCTCCCGGCCGCGGCTGGACGG + Intronic
1150392608 17:64798667-64798689 TCCTGTTGGCACAGACTGGAGGG - Intergenic
1151670968 17:75571560-75571582 CCCTCCTGGGAGAGGCTGGAAGG - Intronic
1151680506 17:75620398-75620420 TCCACTTGGCAGAGGCTGCCCGG + Intergenic
1151721867 17:75861489-75861511 CCCTCTTGGCAGAGCCTGGCAGG + Intergenic
1152188592 17:78874399-78874421 TCCAATAGGCCGTGGCTGGAGGG - Intronic
1153708512 18:7772633-7772655 TCATCTATTCAGAGGCTGGCTGG + Intronic
1153746494 18:8185269-8185291 TCCTCTAGGGTAAGGCTGGCTGG + Intronic
1154163390 18:11996393-11996415 GCCTCTACGCAGCAGCTGGATGG - Intronic
1155549593 18:26950937-26950959 TCCTCTAACCAAAAGCTGGAGGG - Intronic
1156164063 18:34396773-34396795 TCCTCTTGGCAGAAGAGGGAGGG + Intergenic
1157182469 18:45509930-45509952 TCTGTTAGGCAGAGGATGGATGG - Intronic
1157558961 18:48632741-48632763 TGCTCTCGGCAGGGGCTGTAAGG - Intronic
1157562543 18:48659033-48659055 TGCTCTGGGCTAAGGCTGGAAGG + Intronic
1160352962 18:78200801-78200823 TACTCTTGGCAGAGGGTGAAAGG + Intergenic
1160837355 19:1131207-1131229 TCCGCTGAGCTGAGGCTGGAGGG - Intronic
1161143430 19:2662797-2662819 TCCCCTCCCCAGAGGCTGGAGGG + Intronic
1162306316 19:9876376-9876398 TCCCCCAGGCAGCGGCTGGAGGG + Intronic
1163509844 19:17727893-17727915 TCCACCATGCAGATGCTGGATGG - Exonic
1164883266 19:31754525-31754547 TACTCAAGGCAGAAGGTGGAGGG + Intergenic
1164952723 19:32351561-32351583 TCATCTTGGCAGGGGCTGAAGGG + Intronic
1167172773 19:47844313-47844335 CCCAAGAGGCAGAGGCTGGAGGG - Intergenic
1168134520 19:54341513-54341535 TCTCCATGGCAGAGGCTGGAGGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925201175 2:1968764-1968786 CTCTTTAGGCAGAGGCTGCACGG + Intronic
925568473 2:5283123-5283145 TCCTATATGCAGAAGCTGGAAGG + Intergenic
927486638 2:23492457-23492479 TCCAATAAGCTGAGGCTGGAGGG - Intronic
927615932 2:24595741-24595763 ACCTCTATGCAGAGGCTGCAAGG - Intronic
931920238 2:67007515-67007537 TCCTCTAAGCAGGGGTTGGGGGG - Intergenic
932553831 2:72799987-72800009 CCCTGGAGGCAGAGGCTGCAGGG + Intronic
933047368 2:77556272-77556294 TACTCTTGGCAGATGCTGGGTGG + Intronic
933199645 2:79434572-79434594 TCCACAGGGCTGAGGCTGGAGGG + Intronic
934580707 2:95435387-95435409 TCCTCCAGGCAGAGGCGAGTGGG - Intergenic
934598744 2:95641330-95641352 TCCTCCAGGCAGAGGCGAGTGGG + Intergenic
934915159 2:98295597-98295619 TTCTCTGGGCAGAGGCTGGCGGG - Intronic
935620797 2:105127933-105127955 TCCTCTAGTCTGAGGCTGTGAGG + Intergenic
938246305 2:129780315-129780337 TCCTTTTGGCAGAGGCTGTGTGG - Intergenic
939590967 2:144062984-144063006 TACTCTAGCCTGGGGCTGGATGG - Intronic
940584131 2:155622608-155622630 ACCTTAAGGCAGAGGGTGGACGG + Intergenic
940899906 2:159117104-159117126 TCCTCTATGCTGAGGGTGAAAGG + Intronic
941894235 2:170613386-170613408 TGCTCTGGGTAGAGGATGGAAGG - Intronic
945974526 2:216259835-216259857 TCCAGTAGGCAGAAGGTGGAGGG + Intronic
946252774 2:218423696-218423718 TTCTCTAGGGGCAGGCTGGAAGG + Intronic
947241309 2:227997281-227997303 TCAACTAGGCAAAGGCTGGGAGG - Intronic
948280806 2:236746903-236746925 GCCTCTAAGCAGAAGCTTGAGGG + Intergenic
948339477 2:237237957-237237979 TCCTTCAGGCAGAAGCTAGAAGG + Intergenic
948899672 2:240949927-240949949 CCCTCATGGAAGAGGCTGGAAGG + Intronic
1168765376 20:378666-378688 TCCTCTAGGCAGAGGCTGGATGG - Intronic
1170732796 20:18988943-18988965 ACCTGGAGGCAGAGGCGGGAGGG + Intergenic
1170872542 20:20220117-20220139 TCCTCTCCGCGGAGGCTGGGGGG - Intronic
1171328646 20:24318212-24318234 TTCTCCAGGCAGAGCCGGGATGG - Intergenic
1171462980 20:25309292-25309314 TCCCCATGGCAGAGGCAGGAGGG - Intronic
1172539146 20:35697900-35697922 TCCTCTAGGCAGTGCCTGAGGGG - Intronic
1172939659 20:38645775-38645797 TCCCCTCGACAGAAGCTGGAGGG - Intronic
1173869163 20:46330885-46330907 GCCTGTGGCCAGAGGCTGGAAGG + Intergenic
1175206084 20:57312388-57312410 TCATCAAGGCAGAGGATGGGAGG + Intergenic
1175309863 20:58004251-58004273 TCATCCAGGCACAGCCTGGAAGG + Intergenic
1175917409 20:62433118-62433140 TCCTCTGGGCTGAGACGGGATGG + Intergenic
1176898440 21:14411488-14411510 GCCTCTGGGCAGAGACTGTAGGG + Intergenic
1180082683 21:45493928-45493950 GCCCCCAGGAAGAGGCTGGAGGG - Intronic
1180746246 22:18090885-18090907 GCCTCTAGGAAGGGGCTAGAAGG + Exonic
1181307725 22:21926573-21926595 TCCTTTGGGCAGAGGCTGATAGG - Intronic
1181786245 22:25229415-25229437 TCCTATTGGCAGAGGATGGGGGG - Exonic
1181818415 22:25457238-25457260 TCCTATTGGCAGAGGATGGGGGG - Intergenic
1181855343 22:25777531-25777553 CTCCCTAGGCAGTGGCTGGATGG + Intronic
1181915090 22:26273527-26273549 GGCTCTGGGCAGAGGCTGGCTGG + Intronic
1182938262 22:34247756-34247778 TCCTGGAGGCAGAGGTTGCAAGG - Intergenic
1183355076 22:37354219-37354241 CCCTCGAGGGAGAGGCTGGCAGG + Intergenic
1184347932 22:43924491-43924513 TCCTCTCGGGAGGGGCTGGACGG + Intronic
1184528086 22:45037244-45037266 TCCCCTAGGGAGAGGGTGTAGGG - Intergenic
1184641972 22:45877649-45877671 TCGTCCAGGAAGAGGATGGAAGG + Intergenic
950880769 3:16321191-16321213 TCCTCGAGCCACAGGATGGATGG + Intronic
952931188 3:38362081-38362103 TCCAGGAGCCAGAGGCTGGAGGG - Intronic
954314731 3:49794960-49794982 TCATAAAGGCAGAGGCTGGCAGG + Exonic
954400408 3:50316744-50316766 TGCTGTGGGCAGAGGCAGGAGGG - Intergenic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
956214234 3:66831970-66831992 TTCTCTAGGCTGAGGCTGAGAGG - Intergenic
958449748 3:94259012-94259034 TCCAGGAGGCAGGGGCTGGAGGG + Intergenic
961482898 3:127195543-127195565 TCCTTTTGGCAGAGCCTAGAGGG - Intronic
961633426 3:128317986-128318008 CACTCCAGGCAGAGGCAGGATGG + Intronic
962355099 3:134686948-134686970 TCCTCCATGCAGAGTCTGAAGGG + Intronic
963104287 3:141632813-141632835 TCCTCAAGGAAGAGGTTGGGTGG - Intergenic
964185704 3:153940124-153940146 TTCTCTAGGCAGCTGATGGAGGG - Intergenic
964282402 3:155080325-155080347 TCCCCAAGGCAGAGGCCGCAGGG - Intronic
964417560 3:156463482-156463504 TCCTAGAGGAAGAGGCTGAATGG - Intronic
964681537 3:159345472-159345494 TCCCCAAGGCAGAGCCAGGAAGG + Intronic
965360566 3:167734553-167734575 TCCTCTAGGTGGGGGCGGGAGGG - Intronic
966845887 3:184129440-184129462 TCTTCTAGGCTGAGGTTTGAGGG - Intergenic
968519794 4:1030161-1030183 TCCTGGAGGCAGAGGCAGGGAGG + Intergenic
968619732 4:1598422-1598444 TCCTCAAAGCAGAGGCTGACGGG + Intergenic
973252348 4:48073628-48073650 TCCACTCCGCAGAGGCTTGAAGG - Intronic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
974640717 4:64626270-64626292 TCTTCAAGACAGAGGATGGAGGG + Intergenic
980964757 4:139510267-139510289 ACCTCGATGCAGCGGCTGGAAGG - Exonic
981044393 4:140252615-140252637 TCCACCAGGCAGAGGTTGGGGGG + Intergenic
983287659 4:165760350-165760372 TCCTCTAGGCAGAGCCTAACAGG + Intergenic
984456609 4:179977287-179977309 TCCTCTAGAAAGAGGCTCAAGGG + Intergenic
984645141 4:182210950-182210972 ACCTATAGGAAGGGGCTGGAAGG - Intronic
986133003 5:4948134-4948156 TTCACTAAGAAGAGGCTGGAGGG - Intergenic
988140422 5:27232224-27232246 CCCTGGAGGCAGAGGCTGCAAGG - Intergenic
989405309 5:41054332-41054354 TGCTCTAGGTAGAGTCTGGTTGG + Intronic
990276618 5:54203887-54203909 TCCTACAGGCAGGGGCAGGAGGG + Intronic
991917890 5:71623452-71623474 TGCTCTAGGAAGAGGCTGTATGG - Intronic
992465792 5:77002755-77002777 CCCTGGAGGCAGAGGCTGTAGGG + Intergenic
992838520 5:80664388-80664410 CCCTCCAGGCAGAAGCTGGGAGG - Intronic
995798091 5:115962478-115962500 TCCTCCTGGAAGAGCCTGGACGG - Exonic
1001605495 5:172957117-172957139 TTCTCGAGGCAGTGGCTGCATGG - Intergenic
1002059667 5:176619120-176619142 TCTTCCAGCTAGAGGCTGGAGGG + Intergenic
1002842400 6:917605-917627 TCCTCTTGACAGGGGCTGCATGG - Intergenic
1002888697 6:1316802-1316824 TTTTCTGGGCAGATGCTGGAAGG - Intergenic
1003310470 6:4965658-4965680 TCCTGTGGGCAGAGGCTCCAGGG - Intergenic
1003325014 6:5084858-5084880 TTGCCTACGCAGAGGCTGGAAGG - Exonic
1005839598 6:29733660-29733682 TGCTTTAGGCTGAGGTTGGAAGG - Intronic
1006015234 6:31075523-31075545 ATCTCTAAGCAGAGGCTGCATGG - Intergenic
1007398023 6:41588192-41588214 TCCCCGGGGCTGAGGCTGGAGGG - Intronic
1007751852 6:44075924-44075946 TCATCCAGGCAGGGTCTGGAAGG - Intergenic
1008070612 6:47095408-47095430 TCCTGGAGGCAGAGGTTGCAGGG + Intergenic
1008645001 6:53504839-53504861 TCCTCTTGGCAGAGAGTGGCTGG - Intronic
1009311103 6:62153834-62153856 TGCTTTAGGCAAAGCCTGGATGG - Intronic
1009760871 6:68003673-68003695 ACCGCTAGGCAGAAGCTGAAAGG - Intergenic
1010332103 6:74635310-74635332 TGTTCTAGGCAGAGGCAGGCAGG - Intergenic
1012171006 6:96016316-96016338 TCCTCCAGGCAGAGGGTCCAGGG + Intronic
1012289381 6:97434084-97434106 TCTTCTAAGCAGAGGCTCTATGG + Intergenic
1012909256 6:105101175-105101197 TCATCTTGGCAGAGGCTCGCTGG + Exonic
1016356371 6:143223127-143223149 TCTGCTAGACAGAGGCTGGCTGG - Intronic
1018584440 6:165340735-165340757 TGCTCCAGGCAGAGACTGCAGGG + Intronic
1019563388 7:1668598-1668620 TCCACTAGGGAGAAGCTGGTCGG - Intergenic
1020028719 7:4918123-4918145 TCCTGTAGTCAGAGGCTGGCTGG - Intronic
1022001883 7:26233713-26233735 CCCTGTAGGCAGAGGTTGCAGGG + Intergenic
1022206155 7:28165618-28165640 TGTTCCAGGCAGAGGCTGCAAGG - Intronic
1023986363 7:45099458-45099480 GTCTCTAAGGAGAGGCTGGAAGG + Intergenic
1024033483 7:45485224-45485246 GCCACTTGGCAGAGTCTGGAGGG - Intergenic
1024457206 7:49622354-49622376 TCCTCTAGGCAAATGGTGGGTGG - Intergenic
1026664454 7:72330390-72330412 TCCAGTAAGCAGAGGCTGCAGGG + Intronic
1026890319 7:73977840-73977862 TCCTCAAGAGACAGGCTGGAGGG + Intergenic
1029133630 7:98352564-98352586 CCCTGGAGGCAGAGGCTGCAGGG + Intronic
1029991047 7:104962774-104962796 TTCTCTAGGCTGAGGGAGGAGGG - Intergenic
1033156463 7:138961139-138961161 TCCTCTAGGCACACACTGGGAGG + Intronic
1033679929 7:143584004-143584026 TCCTCTAGGGAGAGGAGGAAAGG + Intergenic
1033691905 7:143745439-143745461 TCCTCTAGGGAGAGGAGGAAAGG - Intergenic
1034263531 7:149771410-149771432 TTCTCTGGGGAGAGGCTTGAGGG + Intronic
1035229913 7:157458711-157458733 TGCTCCAGGCAGAGGCTGAGGGG - Intergenic
1035535297 8:386336-386358 TCCTCAGGCCAGAGGCTGGGCGG - Intergenic
1035700764 8:1638037-1638059 GCCTGGAGGGAGAGGCTGGAAGG + Intronic
1036077332 8:5516175-5516197 CCCACTACGAAGAGGCTGGAAGG - Intergenic
1036213406 8:6860814-6860836 TCTTGTAGCCAGAGGCTGCATGG + Intergenic
1036571973 8:9987888-9987910 TCCTCTAAGTAAAGGCTCGAAGG - Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038180029 8:25218765-25218787 TCTTCTAGGGAGAGGCTTGAAGG + Intronic
1038506126 8:28086657-28086679 TCATCTAGCAACAGGCTGGAGGG - Intergenic
1039555972 8:38475233-38475255 TCCTCTGGGCAGAGGCAGCCGGG - Intergenic
1039807435 8:41012633-41012655 GCATAGAGGCAGAGGCTGGAGGG - Intergenic
1040006795 8:42627918-42627940 TGCTCCAGCCAGGGGCTGGAGGG + Intergenic
1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG + Intergenic
1041932097 8:63298038-63298060 TGCTCTAAGAAGAGACTGGAAGG + Intergenic
1042185672 8:66134454-66134476 TCCTGGGGCCAGAGGCTGGAGGG + Intronic
1042199412 8:66266759-66266781 TACTCTAGGCTGGGGCTGGGAGG + Intergenic
1042989222 8:74620345-74620367 TCCTCTAGGCAGTGCCCGCATGG + Intronic
1044744396 8:95358004-95358026 TGCTCTAGGAAGAGGCATGAAGG - Intergenic
1046751853 8:117934618-117934640 TTCTCTAGCCAGAAGCTGAAAGG - Intronic
1046870986 8:119205792-119205814 TCCCATAAGCACAGGCTGGAAGG + Intronic
1048017322 8:130509102-130509124 TCCTGGAGGCAGAGACTGGAGGG - Intergenic
1048961176 8:139579634-139579656 TTCCCTTGGCAAAGGCTGGAAGG - Intergenic
1051569029 9:18534872-18534894 TGCTCTAGGCAGCCTCTGGATGG - Intronic
1051710124 9:19923106-19923128 TCCACTAGGCACAGTGTGGAGGG - Intergenic
1055772322 9:79730671-79730693 TCCTCTTGGAAGAGGCAGGGGGG - Intergenic
1056832018 9:89924836-89924858 TCCTCCAGGCAGATACTGCAGGG - Intergenic
1059254182 9:112913766-112913788 TCCTATAGGAAGATGCTGGGTGG + Intergenic
1060851600 9:126881212-126881234 GCCTCTTGGCAGAGAATGGAGGG - Exonic
1061840913 9:133358127-133358149 CGCTCGAGGCTGAGGCTGGAGGG + Intronic
1062197265 9:135281298-135281320 TCCTGCAGGCTGAGGCTGGGAGG - Intergenic
1062355877 9:136162091-136162113 GCCTCCAGGCAGAGGCTGCTGGG - Intergenic
1062468721 9:136692748-136692770 TCCTGTGGGCAGAGGCAGGCGGG + Intergenic
1186517542 X:10177270-10177292 TCGTCTAGACAGAGACTGCATGG + Intronic
1188242411 X:27808608-27808630 GGCTTAAGGCAGAGGCTGGACGG - Intronic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1189225764 X:39412009-39412031 ACCTAGAGGCAGAGGCCGGAGGG - Intergenic
1198084002 X:133265784-133265806 GCCTCTGGGAAGGGGCTGGAAGG + Intergenic