ID: 1168773237

View in Genome Browser
Species Human (GRCh38)
Location 20:429130-429152
Sequence CCTCTAAGGCAAAGCCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168773237_1168773244 3 Left 1168773237 20:429130-429152 CCTTGTGGGCTTTGCCTTAGAGG 0: 1
1: 0
2: 1
3: 16
4: 133
Right 1168773244 20:429156-429178 GCTGGGAAAACTACAGCCCATGG 0: 1
1: 0
2: 5
3: 58
4: 365
1168773237_1168773245 4 Left 1168773237 20:429130-429152 CCTTGTGGGCTTTGCCTTAGAGG 0: 1
1: 0
2: 1
3: 16
4: 133
Right 1168773245 20:429157-429179 CTGGGAAAACTACAGCCCATGGG 0: 1
1: 0
2: 2
3: 40
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168773237 Original CRISPR CCTCTAAGGCAAAGCCCACA AGG (reversed) Intronic
902152493 1:14455005-14455027 GCTCTATGGAGAAGCCCACAAGG - Intergenic
902561669 1:17281402-17281424 CATCAGAGGCAAAGCCCTCAAGG - Intronic
902967024 1:20012739-20012761 CCACTAAGGCAATGCCCAGTGGG - Intergenic
903227804 1:21903773-21903795 CCTCCAAGGCAGAGACCACATGG - Intronic
904444378 1:30556081-30556103 CTTCTAATGCAGAGCCCCCAAGG + Intergenic
905791605 1:40792518-40792540 GCTCAAGGGCACAGCCCACACGG + Intronic
905915954 1:41684387-41684409 CCTCCAAGGCCAAGCTCACATGG + Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
908386060 1:63643124-63643146 CCCTGTAGGCAAAGCCCACAGGG + Intronic
912508525 1:110172872-110172894 CCTTAAGGGCAAAGCCTACAGGG + Intronic
912678633 1:111711445-111711467 TCTCTAAGGTAAAACTCACAAGG - Intronic
915523380 1:156461804-156461826 GCTCTATGGAAAGGCCCACATGG - Intergenic
921595077 1:217045804-217045826 CCTCTGAGGGAAAGCGCCCAAGG - Intronic
1065399857 10:25286917-25286939 TCTCTAAGGCACAGCACAAAGGG - Intronic
1075483924 10:122805124-122805146 CCTCTAAGGAAAATCAAACAAGG + Intergenic
1076283587 10:129272305-129272327 CCTCTATGTCAAGGCCCACACGG + Intergenic
1077142602 11:1031082-1031104 CCTCTGAGGCCCAGCCCCCACGG - Intronic
1077159795 11:1107505-1107527 CCTCCCAGGCAAAGCCCCCGGGG - Intergenic
1078134789 11:8642953-8642975 CAATTAAGTCAAAGCCCACAGGG + Intronic
1084096722 11:66916160-66916182 ACGCTAAGGGAAAGACCACAGGG - Intronic
1084445892 11:69203270-69203292 CCTCTGACTCAAAACCCACAGGG - Intergenic
1084981308 11:72830162-72830184 CTTACAAGGCAGAGCCCACAGGG + Intronic
1085820497 11:79788144-79788166 CCTCTCAGGGAAAGCCCACTAGG - Intergenic
1091304539 11:134529278-134529300 CAAGTAAGACAAAGCCCACACGG + Intergenic
1094494274 12:30979691-30979713 CCTTGAAGGCCAAGCCCACAAGG + Intronic
1095086609 12:38063026-38063048 GCTCTAAGACAGAGCCCAGAGGG - Intergenic
1096544253 12:52326907-52326929 CATCAAAGGGAAAGCCCAAATGG + Intergenic
1097912865 12:64989469-64989491 ACTCTAAGGTAAAGCTCACCAGG + Intergenic
1098329827 12:69341496-69341518 CCCCTAAGCCAAACCCCACAGGG + Intergenic
1100199606 12:92284335-92284357 TCTTTAGGGCAAAGCCCATAGGG - Intergenic
1102442054 12:112971001-112971023 CCTCTAGAGCAAGGCCCACCAGG + Exonic
1104118672 12:125775436-125775458 CCCCTTAGGCAAAGCCAGCAGGG + Intergenic
1104965185 12:132505750-132505772 CCTGCCAGGCGAAGCCCACAGGG + Intronic
1109166312 13:59039749-59039771 CCTCTAGGCCTAGGCCCACAGGG + Intergenic
1110412852 13:75222488-75222510 CATCTATGGCAAAGCCAACTTGG - Intergenic
1114859138 14:26493703-26493725 CCTCTAAAGGAAAGGCCAGATGG - Intronic
1116051375 14:39807545-39807567 GCTCCTAGGCAAGGCCCACACGG - Intergenic
1118055856 14:62078889-62078911 CCCCTAAGGCACAGCCTATATGG - Intronic
1118864560 14:69692849-69692871 CCTCTCAGGAAAGGCCCAGATGG - Intronic
1119726479 14:76924705-76924727 CCTCTAAGGCAGCGACCACGTGG - Intergenic
1126724507 15:51617940-51617962 ACACTAAGCCCAAGCCCACAAGG + Intronic
1126868366 15:52960716-52960738 CTTCAAAGGCAAAGCCCCCAAGG - Intergenic
1127736517 15:61845099-61845121 CCTCTAGGGCAAAGTGCAAAGGG - Intergenic
1127806685 15:62527413-62527435 TGTCTAAGGAAAAGCCCACCTGG + Intronic
1129868318 15:78925377-78925399 CCTCAAAGGCAAAGCTCACAGGG + Exonic
1131789391 15:95947878-95947900 CCTCTGAGGCATTTCCCACATGG + Intergenic
1132990645 16:2791140-2791162 CCTCTAAGGGCAAGCCGACCTGG - Intergenic
1133055702 16:3144506-3144528 CCACTAAGGCACACCCCACAGGG - Exonic
1134030695 16:10990195-10990217 CCTCAATGGCAAAGCCAAAAGGG - Intronic
1138335092 16:56246621-56246643 CCCATAAGGAAAAGCTCACACGG + Intronic
1147553422 17:41461143-41461165 TCTCTGAGACAAAGCCCCCATGG + Intronic
1151466917 17:74291498-74291520 GCTATAGGGCAGAGCCCACATGG + Intronic
1153660070 18:7318138-7318160 TCACTAAGGCCAAGGCCACAGGG - Intergenic
1155712901 18:28904852-28904874 ACTCTAAGGCAAAGAGCAGAAGG + Intergenic
1157397648 18:47356065-47356087 CCTCGCAGGCCAAGCCCACTAGG - Intergenic
1157587447 18:48813796-48813818 GCTCTCAGGCAAAGCCCTCTGGG - Intronic
1160019907 18:75172439-75172461 ACTCCATGGCAAAGCCCTCACGG - Intergenic
1163685705 19:18710527-18710549 CCTCTGACCCAAAGCCCCCATGG - Intronic
1164161124 19:22625902-22625924 CCTCCCAGCCAAAGCACACATGG - Intergenic
1164599583 19:29551951-29551973 CCTACAAGGCAAGGCCCAGAGGG - Intronic
1165323336 19:35099666-35099688 CCTCCAGGGCAAAGCCCTCGAGG - Intergenic
925025154 2:601568-601590 CCATTAAGCCAAAGCCCACATGG - Intergenic
925444436 2:3915639-3915661 CCTCCAAGCTATAGCCCACAGGG - Intergenic
925444465 2:3915735-3915757 CCTCTAAGCTATAGCCCACAGGG - Intergenic
925753928 2:7115582-7115604 CCTCTAAGGTACAGCACATAGGG - Intergenic
925839129 2:7974598-7974620 ACTCTCAGGAAAGGCCCACATGG - Intergenic
926872122 2:17432412-17432434 ACTCTAAGGCACAGTCCAAAAGG - Intergenic
927698617 2:25253282-25253304 CCTCGAGGGCAGAGCCAACAGGG - Intronic
929539361 2:42808519-42808541 TCTCTCAGGCAGAGCCCACCTGG - Intergenic
933303190 2:80566172-80566194 GCTCTAAAGAAAAGCCCACGTGG - Intronic
936492434 2:112983717-112983739 ACTCCTCGGCAAAGCCCACAGGG - Intronic
938113389 2:128586884-128586906 TCTCAAAGGCAAGGCCCAAAAGG - Intergenic
945027069 2:205629682-205629704 ACTCAAAGGCACAGCCCAGAGGG - Intergenic
945708521 2:213266394-213266416 ATTCTGAGGAAAAGCCCACATGG + Intergenic
946199430 2:218063199-218063221 ACTCTAAGGCAATGGCCAGAGGG - Intronic
946403506 2:219481070-219481092 CCTCTAAAGCACAGGCCACTAGG + Intronic
947264775 2:228266553-228266575 CCTCCAAGGCAAATCCCTCAGGG - Intergenic
948757755 2:240169153-240169175 CCTCTCAGCCAATCCCCACAGGG - Intergenic
1168773237 20:429130-429152 CCTCTAAGGCAAAGCCCACAAGG - Intronic
1169591188 20:7144488-7144510 CCTCTAAGAAAAAGCTCACCAGG - Intergenic
1170482734 20:16783451-16783473 TCTCTAAGACAAAGCTAACATGG - Intergenic
1173548710 20:43917233-43917255 CCACTAAGGCCATGCCCACTTGG - Intronic
1173847829 20:46199303-46199325 CCTGTCAGTCAAAGCCCACGGGG - Intronic
1175587151 20:60150207-60150229 ACAATAAGGTAAAGCCCACATGG + Intergenic
1180060283 21:45381516-45381538 CTGCTGAGGCAAAGCCCACCCGG + Intergenic
1180589632 22:16926034-16926056 CATCTAAGGCACATCCAACAGGG - Intergenic
1181573736 22:23781357-23781379 CCTCGAAGGCAGCGTCCACAGGG - Exonic
1181845954 22:25708631-25708653 ACTCCAAGGAAAAGCCCGCATGG - Intronic
1182849967 22:33465334-33465356 GCTCTGGGGCAAAGACCACATGG + Intronic
1183717133 22:39540107-39540129 TCTCGAAGGCTGAGCCCACAGGG - Intergenic
949861757 3:8511789-8511811 CCTCTCAAGCAAAACCCACTGGG + Intronic
950608841 3:14111486-14111508 CCTTTAAGGCAAAGGCCATGTGG + Intergenic
950663231 3:14479841-14479863 CCTCCATGGCAAAGCCGTCAGGG + Intronic
951651112 3:24952559-24952581 CCTAGAAGGAAAAGACCACATGG + Intergenic
954150147 3:48653224-48653246 CCTCCAAGTCCCAGCCCACATGG - Intronic
954514477 3:51160427-51160449 CCTCTAAGGTGAAGACTACAGGG - Intronic
954701177 3:52451634-52451656 CCTATCAGGCAGAGGCCACAGGG + Intronic
955735832 3:62037384-62037406 CCTATAATGCAAAGAACACAGGG - Intronic
956655604 3:71547433-71547455 CCTCTAGGGCGAGGCCCAGATGG + Intronic
961739015 3:129020892-129020914 CCTCCAAGTCCAAACCCACAGGG + Intronic
961787944 3:129358801-129358823 CCTCAGAGGCACAGCGCACATGG + Intergenic
962721845 3:138183340-138183362 CCTATAAAGGAAAGTCCACAAGG - Intergenic
962850978 3:139308205-139308227 CCTCTAAAGCAAACCCTACATGG + Intronic
963100025 3:141592448-141592470 ACTCAAAGTAAAAGCCCACAAGG - Intronic
966680020 3:182631942-182631964 CCTCTGAGGCAGATCTCACAGGG + Intergenic
966882685 3:184359086-184359108 CCTCTTTGGCAAAGGCCCCAAGG + Exonic
967858659 3:194135875-194135897 TCTCTAAACCAAAGCCCAGAGGG + Intergenic
979652097 4:123146811-123146833 ACTACAAGGCAAAGCGCACAGGG + Intronic
981172977 4:141646200-141646222 CCTCTATTCCAAACCCCACATGG + Intronic
986113547 5:4746682-4746704 TCTCTAGAGCAAACCCCACATGG + Intergenic
988488608 5:31688498-31688520 CCTCTGTGGCAAAACCCACGGGG + Intronic
989983979 5:50674427-50674449 GATCTAAGTCAAAGCCAACAGGG - Intronic
993487697 5:88506690-88506712 CCTCAAAGCCAAAGCCTAAAGGG - Intergenic
996848441 5:127926872-127926894 ACTCTGAGGAAAAGCTCACAGGG + Intergenic
998535506 5:142926666-142926688 CCTCTACCACAAAGCACACAGGG - Intronic
999136795 5:149325877-149325899 CCATGAAGGCAAAGCCCTCATGG + Intronic
999258842 5:150225415-150225437 CCTCCAAGGCTGAACCCACAAGG - Intronic
1001982308 5:176045701-176045723 CCTCAAGGGCAAAGGCCACACGG - Intergenic
1002235153 5:177798356-177798378 CCTCAAGGGCAAAGGCCACACGG + Intergenic
1002665797 5:180823610-180823632 CCTACAAGGCAAAGCTCACGTGG - Intergenic
1004868615 6:19879713-19879735 CCTGTAAGTCAAAGCAAACATGG + Intergenic
1005992814 6:30914125-30914147 CCGCGAAGGCAAACCCCACGGGG - Intronic
1007320024 6:41021404-41021426 CCTCTGAGACAAATCCCACTAGG + Intergenic
1007776638 6:44227682-44227704 CATCTAAGGCAGAGGCCCCAGGG - Intronic
1011312528 6:85995887-85995909 CCTGTAAGGTAAACACCACAAGG + Intergenic
1014760015 6:125346058-125346080 CGTCTAATGCAAAGCCATCAAGG + Intergenic
1017872686 6:158500542-158500564 TCTCTAAGGGAAAAGCCACAGGG + Intronic
1020465409 7:8472980-8473002 CCTCTTATGGAAGGCCCACAAGG - Intronic
1028846126 7:95482407-95482429 CCTCAAGGTCAAAGGCCACAGGG - Intronic
1029609333 7:101618349-101618371 CCTCGGAGGCAAATCCCACATGG - Intronic
1030018798 7:105251558-105251580 CCTCTAAGCTTAATCCCACAAGG + Intronic
1031128199 7:117799316-117799338 CCCCTAAGGTAAATCTCACATGG - Intronic
1033008282 7:137591096-137591118 TCACAAAGGCAGAGCCCACAGGG + Intronic
1034556029 7:151850940-151850962 GCTCCAAGGCACGGCCCACAGGG + Intronic
1036190952 8:6670503-6670525 CCAATAAGACATAGCCCACAGGG + Intergenic
1037658818 8:20909928-20909950 CCTTTAAGGCAAAGCAAAAAGGG + Intergenic
1047697095 8:127414939-127414961 GCTTTATGGAAAAGCCCACATGG + Exonic
1049795419 8:144495143-144495165 CCTCTGAGGCTAGGCCTACAGGG + Intronic
1057163382 9:92907233-92907255 CCTGGAAGGCAAAGACCAAAAGG + Intergenic
1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG + Intergenic
1057855702 9:98599368-98599390 CCACTATGGCAAGGCCCTCAGGG - Intronic
1058114055 9:101064942-101064964 TCTCAAAGGCAGAGCCCTCATGG - Intronic
1061723079 9:132565725-132565747 CCAGGAAGGCAGAGCCCACATGG - Intronic
1185941331 X:4322930-4322952 CCCCTAAGGAAAAGCCCACCAGG - Intergenic
1186372454 X:8961084-8961106 CCCCAAAGGCAAAGTTCACAGGG - Intergenic
1189143745 X:38634966-38634988 TATCTAGGGCAAAGGCCACAAGG + Intronic
1194565309 X:95479682-95479704 CATATTAGGCTAAGCCCACACGG + Intergenic
1195332019 X:103810365-103810387 ACTCTGATGCAAAGCCCAGATGG - Intergenic
1196222968 X:113133909-113133931 GCTCTATGGAAAAGCCTACATGG + Intergenic
1196706645 X:118722902-118722924 ACTCTCAGGCAAAACCCAAAGGG + Intergenic
1198078241 X:133214571-133214593 ACTCAAAGGCAAAGCCAAAATGG + Intergenic