ID: 1168773935

View in Genome Browser
Species Human (GRCh38)
Location 20:433114-433136
Sequence TTCGGTCACCACTTCATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168773929_1168773935 13 Left 1168773929 20:433078-433100 CCTCTTAGCTGGTGAAGGCTCCG No data
Right 1168773935 20:433114-433136 TTCGGTCACCACTTCATCCCTGG No data
1168773932_1168773935 -7 Left 1168773932 20:433098-433120 CCGGCCTGTTCCTGCTTTCGGTC No data
Right 1168773935 20:433114-433136 TTCGGTCACCACTTCATCCCTGG No data
1168773926_1168773935 29 Left 1168773926 20:433062-433084 CCAGCTGAGGGTCTCACCTCTTA No data
Right 1168773935 20:433114-433136 TTCGGTCACCACTTCATCCCTGG No data
1168773925_1168773935 30 Left 1168773925 20:433061-433083 CCCAGCTGAGGGTCTCACCTCTT No data
Right 1168773935 20:433114-433136 TTCGGTCACCACTTCATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168773935 Original CRISPR TTCGGTCACCACTTCATCCC TGG Intergenic
No off target data available for this crispr