ID: 1168777639

View in Genome Browser
Species Human (GRCh38)
Location 20:461901-461923
Sequence CGCGTCAATCAAGCCGGCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 12}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168777633_1168777639 25 Left 1168777633 20:461853-461875 CCTTAAAGGAAGAACTGTGTGGT 0: 1
1: 0
2: 1
3: 26
4: 178
Right 1168777639 20:461901-461923 CGCGTCAATCAAGCCGGCGACGG 0: 1
1: 0
2: 0
3: 1
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168777639 Original CRISPR CGCGTCAATCAAGCCGGCGA CGG Intronic
1063424012 10:5937329-5937351 CGCGTGAAGAAAGCCAGCGAGGG + Exonic
1075699800 10:124461957-124461979 CGCCTCCACCGAGCCGGCGATGG - Exonic
1162927556 19:13937941-13937963 AGCGTCTTCCAAGCCGGCGACGG + Exonic
934570751 2:95371886-95371908 CGCTTCAATCCAGGAGGCGAAGG - Intronic
1168777639 20:461901-461923 CGCGTCAATCAAGCCGGCGACGG + Intronic
971060944 4:22968900-22968922 CGCTTCAATCAAACTGGCCAAGG - Intergenic
975205048 4:71636392-71636414 CGCTTGAATCAAGGAGGCGAAGG - Intergenic
1008727324 6:54438641-54438663 CGCTTCAATCCAGGAGGCGAAGG - Intergenic
1011412007 6:87075587-87075609 AGCATCTATCAAGCCGGGGATGG + Intergenic
1050135628 9:2460576-2460598 AGCATCAATCAAGCTGGCGACGG + Intergenic
1056170494 9:83980323-83980345 CACGTCAATCAAGGCGACGGAGG + Intronic
1061393932 9:130333051-130333073 CGTGTCAATGAAGGCGGTGAAGG + Intronic
1062584062 9:137241154-137241176 CCCGTCAATCAAGCTGCCTAAGG - Intergenic
1196070232 X:111512739-111512761 TGCATCAATCAAGCCCGAGAGGG - Intergenic