ID: 1168780826

View in Genome Browser
Species Human (GRCh38)
Location 20:488293-488315
Sequence ACTGATGTGCAGGCTGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 937
Summary {0: 1, 1: 1, 2: 10, 3: 116, 4: 809}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168780826_1168780831 24 Left 1168780826 20:488293-488315 CCGTGCCCAGCCTGCACATCAGT 0: 1
1: 1
2: 10
3: 116
4: 809
Right 1168780831 20:488340-488362 AATTTCTTTCTCTTGGAGAGAGG 0: 1
1: 0
2: 2
3: 44
4: 591
1168780826_1168780830 17 Left 1168780826 20:488293-488315 CCGTGCCCAGCCTGCACATCAGT 0: 1
1: 1
2: 10
3: 116
4: 809
Right 1168780830 20:488333-488355 CTACTTCAATTTCTTTCTCTTGG 0: 1
1: 0
2: 2
3: 59
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168780826 Original CRISPR ACTGATGTGCAGGCTGGGCA CGG (reversed) Intronic
900626033 1:3609079-3609101 TCTGATGAGCAGGCAGGGCTTGG - Intronic
900785390 1:4646517-4646539 ACTGAAGTGGAGGCTGGCCACGG - Intergenic
900923255 1:5687278-5687300 TCTGCTGTGCATGCTGGGCGGGG - Intergenic
901068243 1:6504857-6504879 AGGGAGGTGTAGGCTGGGCACGG - Intronic
901439148 1:9267108-9267130 ACAGATGTTCTGGCTGGGCGCGG - Exonic
901674642 1:10875778-10875800 AATTTTTTGCAGGCTGGGCACGG + Intergenic
902095852 1:13945181-13945203 ATTTATGTGCAGGCTGGGCGTGG + Intergenic
902430771 1:16361412-16361434 GAAAATGTGCAGGCTGGGCATGG - Intronic
902801537 1:18833027-18833049 ACAGAGGAGCAGCCTGGGCAAGG - Intergenic
903198994 1:21717665-21717687 ACTGATGTGACTGCCGGGCACGG + Intronic
903396093 1:23002892-23002914 ATTGTTGGGCAGGCTGGGGAGGG + Intergenic
903423805 1:23238217-23238239 ACCAATGAGCAGGCTGGGCATGG + Intergenic
903532546 1:24042886-24042908 ACAGAAGAGCAGGCTGGGCATGG + Intergenic
903812013 1:26039823-26039845 CCAGATATGCAGGCTGTGCAGGG + Exonic
904120962 1:28197539-28197561 AATGAAGTGTAGGCTGGGCGTGG - Intergenic
904548342 1:31294647-31294669 TGTTATGTGCAGGCTGGGCGCGG + Intronic
904730208 1:32584808-32584830 AATGATGTTTAGGCTGGGCATGG - Intronic
904818531 1:33223600-33223622 ACTGAAGACCAGGCTGGCCATGG + Intergenic
904948053 1:34213829-34213851 AAGGATGTGGATGCTGGGCACGG - Intronic
905169635 1:36101751-36101773 AATGAAGTACAGGCTGGGCATGG + Intronic
905521663 1:38605245-38605267 AGGCAGGTGCAGGCTGGGCAGGG - Intergenic
905549994 1:38829928-38829950 ACTGAAATTCTGGCTGGGCATGG + Intergenic
905562798 1:38940855-38940877 ACTGCACTGCAGCCTGGGCAAGG + Intronic
906267299 1:44442431-44442453 GATAATATGCAGGCTGGGCACGG - Intronic
906481968 1:46204965-46204987 ACTGAGGCACAGGGTGGGCATGG + Intronic
907034016 1:51200380-51200402 ATTGATGTGGAGGCCGGGCGCGG + Intergenic
907041852 1:51268019-51268041 AAAGATGTGATGGCTGGGCATGG - Intronic
907074152 1:51563788-51563810 ACTGGGGTCCAGGCTGGGCGTGG + Intergenic
907255797 1:53177950-53177972 AGTGTTGGGTAGGCTGGGCATGG + Intergenic
908076820 1:60528957-60528979 ACTTAAGAACAGGCTGGGCATGG + Intergenic
908454166 1:64285611-64285633 ACATAAGTGAAGGCTGGGCATGG - Intergenic
908562043 1:65316234-65316256 ATGGAGGTGCAGGCTGGGGAGGG - Intronic
908747045 1:67385918-67385940 ACTGAAGTCCAGGCCGGGCACGG + Intronic
908911860 1:69080618-69080640 ACTGCACTTCAGGCTGGGCATGG - Intergenic
909012336 1:70348558-70348580 AAAAAGGTGCAGGCTGGGCATGG - Intronic
911016098 1:93334372-93334394 ATTAAAGGGCAGGCTGGGCATGG - Intergenic
911218760 1:95224745-95224767 AGTGATATACAGTCTGGGCATGG + Intronic
911244470 1:95501374-95501396 ACTTGTGTGCAGGCAGGGAATGG + Intergenic
911634585 1:100219852-100219874 AATGCTGTGGTGGCTGGGCATGG + Intronic
912565797 1:110586355-110586377 ACTTTTATGCAGGGTGGGCAGGG - Intergenic
913421081 1:118669931-118669953 AATAATGTTCAGGCTGGGCATGG + Intergenic
915303408 1:154964243-154964265 AAAGATGTGGAGGCTGGGCATGG + Intronic
915443250 1:155959837-155959859 AATGTGGTCCAGGCTGGGCACGG - Intronic
915678079 1:157550350-157550372 ACTGATTAGAAGGCAGGGCAAGG + Intronic
915687113 1:157644729-157644751 ACTGATTAGAAGGCAGGGCAAGG + Intergenic
916468461 1:165096174-165096196 ACTAATGTGCTGGCTGGGTGCGG + Intergenic
916655542 1:166872379-166872401 AGTGATCTGCAGGCCGGGCGCGG + Intronic
916672988 1:167041141-167041163 AGTCATGTGAAGGCTGGGCGTGG + Intergenic
916796817 1:168175238-168175260 AATGTAGTGCAGGCTGGGCGTGG + Intergenic
916909008 1:169324143-169324165 ACTGAAGTGGGGGCTGGGCGCGG - Intronic
917133962 1:171770571-171770593 CCTGATGACCTGGCTGGGCATGG - Intergenic
917236819 1:172901585-172901607 ACTGATGTGCAGGTGGCACATGG + Intergenic
917361519 1:174181625-174181647 ACCCTTGTACAGGCTGGGCATGG - Intronic
917595135 1:176521646-176521668 ACTGACGTGCAGCTTTGGCAAGG + Intronic
917918832 1:179732486-179732508 AACAATGTGCTGGCTGGGCATGG - Intergenic
917943402 1:179945906-179945928 ACTGGTTTTTAGGCTGGGCATGG + Intergenic
918121998 1:181548414-181548436 AGTGTTATGGAGGCTGGGCACGG - Intronic
918602409 1:186379151-186379173 TCTGGTGTGTTGGCTGGGCATGG + Intronic
919716566 1:200783776-200783798 AATGAAACGCAGGCTGGGCATGG - Intronic
920515121 1:206579674-206579696 TCTGGGGTGCAGTCTGGGCATGG - Intronic
921104929 1:211967170-211967192 AGTGACGACCAGGCTGGGCACGG + Intronic
921567250 1:216735548-216735570 ACAGAGGTGGAGGCAGGGCAGGG - Intronic
923111585 1:230894875-230894897 AAGGGTGTGCAGGCTGGGCTGGG - Intergenic
923617919 1:235553047-235553069 ACATGTGTGCTGGCTGGGCACGG - Intronic
923630346 1:235645505-235645527 AAGAATGTTCAGGCTGGGCATGG + Intronic
924515158 1:244759922-244759944 CCTGAGATGCAGGCTGGGCGCGG + Intergenic
924559390 1:245144911-245144933 ACTGATGTGCAGAGATGGCAAGG - Intergenic
1062817792 10:513688-513710 AAACATGTGCAGGCTGGACATGG - Intronic
1063128754 10:3159367-3159389 ACGGAGCTGCAGGCTGAGCACGG + Intronic
1063467076 10:6253749-6253771 GGTGATATGCTGGCTGGGCACGG + Intergenic
1064441078 10:15354203-15354225 AGTGGTGGGCAGGCTGGGCATGG + Intronic
1064912407 10:20416881-20416903 ACTAATAAGCAGGCTGGGCATGG - Intergenic
1065615135 10:27513323-27513345 ACTCATGTGTGGGCTGGGCGTGG - Intronic
1065706353 10:28474771-28474793 ATTCATGTGCAGGCCGGGCGCGG + Intergenic
1066068219 10:31778039-31778061 TCAGAAGTCCAGGCTGGGCACGG - Intergenic
1066091493 10:32025664-32025686 ATTCATGTGTAGGCTGAGCATGG - Intronic
1066284765 10:33953935-33953957 AATGATCTGATGGCTGGGCATGG - Intergenic
1066413138 10:35193051-35193073 CCAGATGTGGAGGATGGGCAAGG - Intronic
1067460979 10:46458271-46458293 AATGATATCTAGGCTGGGCACGG + Intergenic
1067626214 10:47926329-47926351 AATGATATCTAGGCTGGGCACGG - Intergenic
1067957386 10:50807253-50807275 ACTGAGGGGCTGGCTGGGCATGG + Intronic
1068107965 10:52643386-52643408 AGTGCAGTCCAGGCTGGGCACGG - Intergenic
1068217238 10:53998759-53998781 AATAACGTGTAGGCTGGGCACGG + Intronic
1068702460 10:60034394-60034416 ACAGAATTTCAGGCTGGGCATGG - Intronic
1068950099 10:62768048-62768070 AGTGCTGTGGTGGCTGGGCACGG - Intergenic
1069090319 10:64192615-64192637 ACCTATGTGCTGGCTGGCCATGG + Intergenic
1069728528 10:70596563-70596585 ACGGCTGTGCAGGCTGTGCAGGG - Intergenic
1070249535 10:74762005-74762027 AATGAGATTCAGGCTGGGCATGG + Intergenic
1071094601 10:81958610-81958632 ACAGATATACAGGCTGGGCATGG + Intronic
1071469731 10:85975301-85975323 GCTGAGGTGCAGGGTGGACAGGG + Intronic
1071533191 10:86404800-86404822 ATTTATCTGGAGGCTGGGCACGG + Intergenic
1071935990 10:90531108-90531130 AATAGTGTGTAGGCTGGGCATGG + Intergenic
1072540323 10:96393591-96393613 AGGCATGTGCAGGCTGGGCCAGG + Intronic
1072745048 10:97933952-97933974 CCTAATGTGCAGCCTGGGCAGGG + Intronic
1072858311 10:98973998-98974020 AATGATTTGTAGGCTGGGCATGG + Intronic
1073496219 10:103893456-103893478 ATGGATCTGTAGGCTGGGCACGG - Intronic
1073934394 10:108613512-108613534 TGTGATTTTCAGGCTGGGCATGG - Intergenic
1075008210 10:118845659-118845681 ACTGAAGTGGTGGCTGGGAAGGG - Intergenic
1075700531 10:124466745-124466767 AATGATATGCAGGCTGGGCGCGG - Intronic
1076299739 10:129415995-129416017 AATGTTGAGCAGGCTGGGCAGGG - Intergenic
1076377245 10:129999643-129999665 ATTGATTTTCTGGCTGGGCACGG - Intergenic
1076725350 10:132410531-132410553 GCTGAGGTGCAGGACGGGCAAGG - Intronic
1076811131 10:132886900-132886922 AAGGGTGTGCAGGCTGGGCTGGG - Intronic
1076826783 10:132973370-132973392 CCAGCTGGGCAGGCTGGGCAGGG + Intergenic
1077362687 11:2147698-2147720 GCTGTGGGGCAGGCTGGGCAGGG + Exonic
1077645452 11:3919493-3919515 ACTCAGTTTCAGGCTGGGCATGG - Intronic
1077648191 11:3945284-3945306 AATGTTGTGTAGGCTGGGCATGG + Intronic
1077727816 11:4693429-4693451 AGTGTTGAGCAGGCTGGGCGCGG + Intronic
1077926253 11:6684259-6684281 ACATATATGCAGGCCGGGCACGG + Intergenic
1077928363 11:6705233-6705255 ATGTATGTTCAGGCTGGGCATGG + Intergenic
1078132596 11:8625010-8625032 ACTGGTTGTCAGGCTGGGCATGG + Exonic
1078504010 11:11916156-11916178 AAGGATGTGCAGGCTGGGCATGG + Intronic
1079117892 11:17652177-17652199 GCTGCTCTGCAGGCTAGGCAGGG - Intergenic
1079125144 11:17713794-17713816 ACTGACATGCGGGCAGGGCAGGG - Intergenic
1080280827 11:30554783-30554805 AATGTGGTGCAGGCTGGGCATGG - Intronic
1080886141 11:36369885-36369907 ACTGAGTTGCAGGCTGGGCATGG - Intronic
1081085483 11:38794981-38795003 ACTTATCACCAGGCTGGGCATGG - Intergenic
1081927314 11:46841708-46841730 AGTGATATGCTGGCTCGGCACGG + Intronic
1082929979 11:58592375-58592397 AAGGATGTGCAGACTGGACACGG - Intronic
1083076185 11:60041555-60041577 ACTGAGTTTCTGGCTGGGCACGG + Intronic
1083239827 11:61379532-61379554 ATTGTAATGCAGGCTGGGCACGG + Intergenic
1083388290 11:62329062-62329084 ATTCATGTGTTGGCTGGGCATGG + Intergenic
1083495100 11:63044858-63044880 ACTGATCTTCAGGCCTGGCACGG - Intergenic
1083578525 11:63810086-63810108 ACTGTAGTCCAGGCTGGGCGTGG - Intergenic
1083628610 11:64084656-64084678 AGTGATGGGCAGGTTGGGCAGGG + Intronic
1083685862 11:64374725-64374747 ATTGAGCTGCAGGCTGGCCAGGG + Intergenic
1083762825 11:64827911-64827933 TTTGATGTGGAGGCTGGGCCGGG - Intronic
1083770838 11:64866403-64866425 ACTGCCTAGCAGGCTGGGCATGG + Intronic
1083786165 11:64948942-64948964 AAAGGGGTGCAGGCTGGGCATGG - Intronic
1083825998 11:65204527-65204549 GGTGATGGGCAGGCTGGGCCAGG - Intronic
1083983589 11:66194252-66194274 TCTGAAGTGCAGGCTGGGCGCGG - Intronic
1085251999 11:75150202-75150224 AGTGCTGTGCAAGCTGGGAAAGG + Intronic
1085426106 11:76405950-76405972 ACTGATCTCCAGGCCAGGCATGG - Exonic
1085970530 11:81584894-81584916 ACTGATTTACTGGCTGGGCGCGG - Intergenic
1086080732 11:82900472-82900494 GCGGAGCTGCAGGCTGGGCAGGG - Intronic
1086315063 11:85582531-85582553 ATTAGTGTCCAGGCTGGGCACGG + Intronic
1086378725 11:86229053-86229075 AGTAATGTGTAGGTTGGGCACGG + Intergenic
1087121238 11:94576422-94576444 AATGATATAGAGGCTGGGCACGG - Intronic
1088628230 11:111748605-111748627 ACTTCAGTGCAGGCTGGGGATGG + Intronic
1089071330 11:115701691-115701713 TAGGAAGTGCAGGCTGGGCAGGG - Intergenic
1089563634 11:119358604-119358626 GATGCTGTGCAGGCCGGGCATGG - Intronic
1090205829 11:124883797-124883819 ATTGTTTTGCTGGCTGGGCACGG - Exonic
1090358608 11:126157479-126157501 AAAGATGTGCAGTCTGGGCTGGG - Intergenic
1090768638 11:129898632-129898654 AATGAAGAGTAGGCTGGGCACGG - Intergenic
1090827504 11:130398124-130398146 AGTGAAGTGCAGGCAGGGCATGG + Intergenic
1090849219 11:130556997-130557019 AGTTATATGCAGGCTGGGCATGG - Intergenic
1091490748 12:930674-930696 AATGGTGTAAAGGCTGGGCATGG + Intronic
1091554320 12:1560819-1560841 AGTGCAGGGCAGGCTGGGCACGG - Intronic
1091743361 12:2975676-2975698 AATAATGTGCTGGCTGGGCACGG - Intronic
1091992979 12:4971873-4971895 ACAGTTCTGCAGGCTGTGCAAGG + Intergenic
1093180335 12:15960345-15960367 AATGATATGCGGGCTGGGGACGG + Intronic
1094499347 12:31008548-31008570 CCTGATGTGCAGGCTGGGGCTGG - Intergenic
1095052870 12:37569690-37569712 ACTGCAGTTCAGCCTGGGCAAGG - Intergenic
1095634071 12:44410684-44410706 ACTGATCAGGAGACTGGGCATGG + Intergenic
1095971815 12:47906926-47906948 ACTGATGTGCAGAGTTGTCAAGG + Intronic
1096048750 12:48587152-48587174 ACTCATGTGCTGGCTGGGCGCGG + Intergenic
1096064737 12:48730645-48730667 ACTGAGGCTCAGGCCGGGCATGG + Intergenic
1096182265 12:49557477-49557499 CCGGAGGTGCTGGCTGGGCACGG - Exonic
1096266572 12:50127670-50127692 AGTGTTGTCTAGGCTGGGCATGG - Intergenic
1096340952 12:50798597-50798619 TCTCAGGTTCAGGCTGGGCATGG - Intronic
1096783685 12:54005177-54005199 CCTGACCTGCAGGCTGGGCTGGG - Intronic
1096813498 12:54186628-54186650 ACAGATTCCCAGGCTGGGCACGG - Intronic
1097812167 12:64031025-64031047 ATTTATCTGCTGGCTGGGCATGG + Intronic
1097953241 12:65456025-65456047 ACTAAATTGCAGGCTGGGCACGG - Intronic
1098008438 12:66023733-66023755 ACTATTGACCAGGCTGGGCATGG + Intergenic
1100161400 12:91865105-91865127 AGTGCTTTTCAGGCTGGGCATGG - Intergenic
1100544720 12:95590705-95590727 ACTCCTCTGCTGGCTGGGCATGG - Intergenic
1100643170 12:96502265-96502287 AATGTTGGCCAGGCTGGGCATGG + Intronic
1100645042 12:96520251-96520273 ACTTAACTTCAGGCTGGGCATGG + Intronic
1101344189 12:103870099-103870121 ATTAATGTGCAGTTTGGGCATGG + Intergenic
1101716784 12:107319113-107319135 GCTGTTGTGCCGGCTGTGCATGG - Exonic
1101768916 12:107730357-107730379 GCTGAGGCTCAGGCTGGGCATGG - Intergenic
1102104840 12:110312557-110312579 ACTGAAGTACAGGCCGGGCATGG + Intronic
1102242951 12:111336736-111336758 ACTGAAGTGTGGGCTGGGCACGG - Intronic
1102363097 12:112305600-112305622 AGAGATGGGCAGGGTGGGCAGGG - Intronic
1102770806 12:115474345-115474367 ACTCATTTGGAGGCTGGGCACGG - Intergenic
1103099788 12:118163574-118163596 ACTTATTTCCTGGCTGGGCATGG - Intronic
1103218500 12:119223147-119223169 ATTTATATGTAGGCTGGGCATGG - Intergenic
1103295360 12:119881738-119881760 ACTGAAATGGAGGCCGGGCATGG + Intergenic
1103517692 12:121518181-121518203 ACTGTTTTATAGGCTGGGCATGG - Intronic
1103959998 12:124603456-124603478 ACTGATGAGCAGCCAGGGCAGGG + Intergenic
1104565207 12:129874965-129874987 AATAATGTGCAGCCCGGGCATGG - Intronic
1104888888 12:132129887-132129909 ACTGCAGTATAGGCTGGGCACGG - Intronic
1104942224 12:132400525-132400547 ACAGATCTGCAGTCTGGGCAGGG + Intergenic
1105488230 13:20859176-20859198 ACTGAAAAGGAGGCTGGGCACGG + Intronic
1105520691 13:21128284-21128306 ACTGTTGTACTGGCTGGGCATGG - Intergenic
1105574145 13:21634395-21634417 TATGATGTGCTGGCTGGGCGTGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105872809 13:24522749-24522771 GATGATGTGCTGGCTGGGCGCGG + Intergenic
1106179331 13:27357782-27357804 AATGCAATGCAGGCTGGGCATGG + Intergenic
1106681681 13:32014766-32014788 GATGTTGTGCAGGGTGGGCATGG + Intergenic
1107503105 13:41001295-41001317 ATTTATATGAAGGCTGGGCATGG + Intronic
1107555680 13:41515441-41515463 CCTGAAGTGCTGGCTGGGCACGG - Intergenic
1107997703 13:45877356-45877378 AATGAGGTTCTGGCTGGGCACGG + Intergenic
1108166122 13:47695020-47695042 ATTACAGTGCAGGCTGGGCACGG - Intergenic
1109651453 13:65332580-65332602 AATGAAGCACAGGCTGGGCACGG + Intergenic
1109985951 13:69984816-69984838 ACTTCTGTGCAGGCTGGGCGTGG + Intronic
1110243445 13:73294237-73294259 ACTACTGAGCTGGCTGGGCATGG + Intergenic
1110441684 13:75533274-75533296 ATGGATATTCAGGCTGGGCACGG + Intronic
1111530421 13:89529812-89529834 GCTGATGTGAAGGCTTGGCCTGG - Intergenic
1111716730 13:91887751-91887773 ACTGATGTCCAGGCTGGAGATGG - Intronic
1111911711 13:94320629-94320651 TCAGATTTGCAGGGTGGGCAAGG - Intronic
1112283516 13:98083530-98083552 AGTAATGTGTAGGCTGGGCCCGG - Intergenic
1113240940 13:108336206-108336228 TGTGATGTGCAGTCTGGCCAGGG + Intergenic
1113481086 13:110621737-110621759 ACATGTGTTCAGGCTGGGCATGG + Intronic
1114201303 14:20523365-20523387 AATGATGGGGAGGCTGGGCATGG - Intergenic
1114316950 14:21518341-21518363 AATGATTTTTAGGCTGGGCACGG - Intergenic
1114404831 14:22446896-22446918 TCTAATTAGCAGGCTGGGCACGG + Intergenic
1114532568 14:23404896-23404918 TCTGATGGCCAGGCTGGGAAGGG - Intronic
1114708100 14:24747961-24747983 ATTGATTTACAGGCTGGGCGTGG + Intergenic
1115164791 14:30436179-30436201 ATGGATGTGCTGGCTGGGCGCGG - Intergenic
1115225444 14:31097110-31097132 AGTTATGTGAAAGCTGGGCATGG - Intergenic
1115526512 14:34285643-34285665 ACTGAGGGTCAGGCTGGCCACGG + Intronic
1115742548 14:36403745-36403767 ACTGTGGTGGAGGGTGGGCAGGG - Intergenic
1115777902 14:36736223-36736245 AATCGTGGGCAGGCTGGGCACGG - Intronic
1115795758 14:36933646-36933668 TCTGATGTGGAGGCTGGTGAAGG - Intronic
1116143079 14:41025623-41025645 AATGATGAGCAGGCTGAGCATGG - Intergenic
1116431649 14:44853110-44853132 ATAGAAGTGCTGGCTGGGCACGG + Intergenic
1116636682 14:47404782-47404804 AATGATAGGTAGGCTGGGCATGG - Intronic
1118210203 14:63759081-63759103 ATTTACATGCAGGCTGGGCACGG + Intergenic
1118413346 14:65505600-65505622 ACTGAGATGTAGGCCGGGCACGG - Intronic
1118432113 14:65729305-65729327 AAAGATGTTTAGGCTGGGCATGG - Intronic
1118994774 14:70825848-70825870 ACTGAGGTCCAGGCTGGGCGAGG - Intergenic
1119360677 14:74046661-74046683 AGTCAAGTGCAGGCTGGGCACGG - Intronic
1119414142 14:74458303-74458325 AGTGCTGTGCAGGCTGGGTGCGG + Intergenic
1119473388 14:74912883-74912905 ACTCATCTGCATGGTGGGCAGGG + Intronic
1119523838 14:75306658-75306680 ACTTTTTTTCAGGCTGGGCATGG + Intergenic
1119610276 14:76056124-76056146 ACTCATCTGCAGGCTAGGTAAGG + Intronic
1119829736 14:77691089-77691111 AGTTATGTGCAGGCCGGGCACGG - Intronic
1120512474 14:85432628-85432650 AAAAATGTGCAGGCTGGGCGCGG + Intergenic
1120880658 14:89413341-89413363 ACAAATGAACAGGCTGGGCATGG + Intronic
1121243213 14:92444562-92444584 AATGAAGTGAAGGCTGGGCGCGG + Intronic
1121351623 14:93177861-93177883 ATTGAAGTTCAGGCTGGGCGTGG - Intergenic
1121423823 14:93834122-93834144 ACAGAAGTCCAGGCAGGGCAGGG - Intergenic
1121522527 14:94596049-94596071 AGTCAAGTGTAGGCTGGGCATGG - Intronic
1121566478 14:94914042-94914064 ACTGAGGTTAAGGCTGGGCTGGG - Intergenic
1122554671 14:102571308-102571330 CCTGCTTTGCAGGCTGGGCTGGG + Intergenic
1122928431 14:104921930-104921952 AAAAATGTTCAGGCTGGGCACGG + Intergenic
1123434256 15:20243551-20243573 CCTAATGAGGAGGCTGGGCACGG + Intergenic
1123509290 15:20979955-20979977 ACTGCTGTGAAGGCTATGCATGG - Intergenic
1123566514 15:21553702-21553724 ACTGCTGTGAAGGCTATGCATGG - Intergenic
1123602775 15:21990988-21991010 ACTGCTGTGAAGGCTATGCATGG - Intergenic
1124342042 15:28895820-28895842 TCTGATTTGAAGGCTGGGCATGG + Intronic
1124470999 15:29985692-29985714 TCCAAAGTGCAGGCTGGGCAGGG - Intergenic
1124965196 15:34428382-34428404 TGTGATTTGAAGGCTGGGCACGG - Intronic
1124981809 15:34574592-34574614 TCTGATTTGAAGGCTGGGCACGG - Intronic
1125164101 15:36682481-36682503 AATGATGTTTGGGCTGGGCAAGG + Intronic
1125331728 15:38589266-38589288 ACTGATCTGGAGGCCAGGCAGGG + Intergenic
1125577231 15:40764179-40764201 GCTGATGAGCAGGTAGGGCATGG - Exonic
1125735462 15:41922096-41922118 AGTGATGATAAGGCTGGGCACGG + Intronic
1126738573 15:51755515-51755537 CCTCATGTCCAGGCTTGGCATGG - Intronic
1127272450 15:57413574-57413596 ACTGAGATGCTGGCCGGGCATGG - Intronic
1127321742 15:57853434-57853456 TCAGAGGTGCAGGCTGGGCTGGG - Intergenic
1127416565 15:58763501-58763523 ACTGAATTTTAGGCTGGGCATGG + Intergenic
1127454311 15:59143512-59143534 AGACATGTGCAGGCTGGCCAGGG - Intronic
1127862321 15:63004513-63004535 AGTGATGAGCAGGTTGTGCATGG + Intergenic
1127947172 15:63766966-63766988 ACTTTAGTGTAGGCTGGGCATGG - Intronic
1128003081 15:64212422-64212444 ATTAATGTGCAGGCCAGGCATGG + Intronic
1128144217 15:65323404-65323426 ACAAATATGCAGTCTGGGCAGGG - Intergenic
1128739983 15:70077006-70077028 AATGAAGTGTTGGCTGGGCATGG - Intronic
1128959812 15:71990373-71990395 ATAGATTTGCTGGCTGGGCATGG - Intronic
1129086029 15:73093335-73093357 CCTGAAGTGCAGGCTGCCCATGG - Intronic
1129156873 15:73723560-73723582 ACTGAGGTGGAGGGAGGGCAGGG + Intergenic
1129898021 15:79122892-79122914 GCTGATGGGAAGGCTGGGGAGGG + Intergenic
1130290173 15:82592130-82592152 ACTGAAGTTCTGGCTGGGCGTGG - Intronic
1130340007 15:82992223-82992245 AATGATTTATAGGCTGGGCACGG + Intronic
1130661853 15:85837087-85837109 AATGAGATGCAGGCCGGGCACGG - Intergenic
1130992993 15:88887671-88887693 GGTTATGGGCAGGCTGGGCATGG + Intronic
1131024037 15:89124661-89124683 AGAGTTGTGCAGACTGGGCATGG + Intronic
1131320820 15:91388917-91388939 ACTGATAAACAGTCTGGGCATGG - Intergenic
1131360272 15:91784486-91784508 ATGGATCTTCAGGCTGGGCACGG - Intergenic
1131858046 15:96620009-96620031 ACTGATATTCAGGCTGTGCTTGG + Intergenic
1132004098 15:98210659-98210681 ACAGATGTAGGGGCTGGGCACGG + Intergenic
1132187377 15:99813233-99813255 AAGGAAGGGCAGGCTGGGCATGG - Intergenic
1132192462 15:99878856-99878878 ATTGAAGTTCAGGCTGGGCACGG - Intergenic
1132316741 15:100895715-100895737 CCCAGTGTGCAGGCTGGGCAAGG - Intronic
1132422533 15:101684660-101684682 ACTCATGAGCAGAGTGGGCAGGG - Intronic
1132428295 15:101739503-101739525 AAGGAAGGGCAGGCTGGGCATGG + Intronic
1202974878 15_KI270727v1_random:280790-280812 ACTGCTGTGAAGGCTATGCATGG - Intergenic
1132475657 16:136397-136419 ACACAAGTGCAGGCTGGGCGCGG + Intronic
1132476565 16:142031-142053 AATGTTATGCAGGCCGGGCACGG - Intergenic
1132736429 16:1388280-1388302 ACTGATCTGAGGGCTGGGCACGG + Intronic
1133211209 16:4264293-4264315 ACAGATGGGCAGGCTGGGTGGGG - Intronic
1133488098 16:6239785-6239807 AGTCAGGTGGAGGCTGGGCATGG - Intronic
1133794395 16:9034168-9034190 ACCAATGTCCAGGCTGGGCGCGG - Intergenic
1134225210 16:12384878-12384900 AGTGCTGTGGAGGCCGGGCATGG + Intronic
1134298543 16:12968874-12968896 TGGGAGGTGCAGGCTGGGCATGG + Intronic
1134469241 16:14508237-14508259 ACAAATAGGCAGGCTGGGCATGG + Intronic
1134659736 16:15975077-15975099 AGTGAGGGGGAGGCTGGGCATGG - Intronic
1134759902 16:16705092-16705114 AATGAAATGCAGGCTGGGCATGG + Intergenic
1134860668 16:17557493-17557515 TCTGAGGTCCAGGCTGGGCGCGG - Intergenic
1134986170 16:18654113-18654135 AATGAAATGCAGGCTGGGCATGG - Intergenic
1135385888 16:22039542-22039564 GTTCATGAGCAGGCTGGGCATGG + Intronic
1135707607 16:24688227-24688249 AAGCATGTCCAGGCTGGGCATGG - Intergenic
1136002022 16:27301982-27302004 AATTAAGTGAAGGCTGGGCATGG - Intergenic
1136089707 16:27909795-27909817 ATCTAGGTGCAGGCTGGGCATGG - Intronic
1136252704 16:29016623-29016645 AAGAATGGGCAGGCTGGGCATGG - Intergenic
1136363315 16:29795978-29796000 ATGGAGGTACAGGCTGGGCAGGG + Intronic
1136400464 16:30014647-30014669 AGCAAAGTGCAGGCTGGGCATGG + Intronic
1136499981 16:30665237-30665259 ACTGACGGGCAGGCTGGACTTGG + Intronic
1136850356 16:33607560-33607582 CCTAATGAGGAGGCTGGGCACGG - Intergenic
1137533514 16:49299624-49299646 ACTCATGAGGTGGCTGGGCACGG + Intergenic
1137658423 16:50181593-50181615 AATAAAGTGAAGGCTGGGCATGG - Intronic
1137662205 16:50218045-50218067 AGTAAGGTGCAGGCTGAGCATGG - Intronic
1138348204 16:56332694-56332716 ACGGCTGTGGAGGGTGGGCAAGG - Intronic
1138381075 16:56602989-56603011 ACTGTTCTCCAGCCTGGGCAGGG - Intergenic
1138964853 16:62071768-62071790 TGTGATGAGCAGGCTGGGCGTGG - Intergenic
1139070918 16:63381476-63381498 ACAAATATGAAGGCTGGGCATGG - Intergenic
1139356341 16:66369048-66369070 ACTGAGGTGCAGGCTGCAGAGGG - Intronic
1139404392 16:66706679-66706701 ACTGGTGTCCATGCTGGGCCTGG + Intergenic
1140069856 16:71639976-71639998 ACTGATGTTGAGGCTGGGTGAGG + Intronic
1140120941 16:72082479-72082501 AATGAAATGCGGGCTGGGCACGG - Intronic
1140496756 16:75396077-75396099 ACTGATGTGAAGGCTGAAAAAGG + Intronic
1140535233 16:75703772-75703794 AATGTTGACCAGGCTGGGCATGG - Intronic
1141120952 16:81355651-81355673 AATGAAGTCCTGGCTGGGCATGG - Intronic
1141199324 16:81884923-81884945 ACTGCTCTCCAGCCTGGGCAAGG - Intronic
1141440170 16:84025097-84025119 ACTGATGTACAGCCAGGGCTGGG + Intronic
1141710137 16:85694011-85694033 AATGGGGTACAGGCTGGGCATGG - Intronic
1142108877 16:88320672-88320694 TCTCATGGTCAGGCTGGGCATGG - Intergenic
1142258121 16:89025420-89025442 AATAATGTCCAGGCTGGGCGCGG + Intergenic
1142356137 16:89602955-89602977 ACTGCTGGGGAGGCAGGGCAGGG + Intergenic
1203111969 16_KI270728v1_random:1456013-1456035 CCTAATGAGGAGGCTGGGCATGG - Intergenic
1142964937 17:3574656-3574678 AATGATGTGGAGGCCGGGCATGG + Intronic
1143170713 17:4928447-4928469 ACCCATCTGGAGGCTGGGCACGG - Intergenic
1143217161 17:5233659-5233681 ACTGAGAGGCAGGCGGGGCATGG - Intronic
1143222353 17:5273230-5273252 TATGGTCTGCAGGCTGGGCATGG + Intergenic
1143280341 17:5749353-5749375 ACTGCAGTGGGGGCTGGGCATGG + Intergenic
1143769655 17:9160393-9160415 AAAGATGTCCGGGCTGGGCATGG - Intronic
1143793189 17:9314811-9314833 ACTGAGTTCCTGGCTGGGCACGG + Intronic
1144338579 17:14294989-14295011 AAGAAAGTGCAGGCTGGGCACGG - Intergenic
1144865083 17:18330424-18330446 ACTGTAGTGGGGGCTGGGCACGG - Intronic
1145182635 17:20766762-20766784 ATTTAGGGGCAGGCTGGGCATGG - Intergenic
1146017940 17:29248718-29248740 ACTGAGGCTCAGGCTGGGCGCGG + Intronic
1146045047 17:29498376-29498398 ACTGATGGACATGCTGGGAATGG - Exonic
1146234971 17:31150739-31150761 AGTGATGCTCCGGCTGGGCACGG + Intronic
1146476997 17:33171013-33171035 ACTGATGTGAAGGCTGGAATTGG + Intronic
1146480547 17:33201737-33201759 GCTGCTGTCTAGGCTGGGCATGG + Intronic
1147217539 17:38909315-38909337 AGTGAAGAGGAGGCTGGGCACGG + Intronic
1147576518 17:41603373-41603395 ACCCATGCCCAGGCTGGGCATGG + Intergenic
1147743846 17:42683348-42683370 ACTGATGCTAAGGCTGGACATGG + Intronic
1148469738 17:47885531-47885553 GCTGATTGGCAGGCTGGGAAGGG + Intergenic
1148600134 17:48887989-48888011 AATGGAATGCAGGCTGGGCACGG + Intergenic
1148655565 17:49280743-49280765 ACTGAAGTTGTGGCTGGGCACGG + Intergenic
1148942531 17:51227268-51227290 ATTGCTTTGCTGGCTGGGCATGG + Intronic
1149127616 17:53254649-53254671 ACTCATGTGCCAGCAGGGCAGGG - Intergenic
1149601250 17:57894270-57894292 TGAGCTGTGCAGGCTGGGCATGG + Intronic
1149788743 17:59458908-59458930 AATGATATTTAGGCTGGGCATGG + Intergenic
1149900281 17:60470554-60470576 AATAAAGAGCAGGCTGGGCATGG - Intronic
1150266362 17:63834655-63834677 GCTGATGTGCAGGTTTGGCAGGG - Intronic
1150429481 17:65103653-65103675 AATGTGGTGGAGGCTGGGCATGG + Intergenic
1150743911 17:67801092-67801114 ACAGATGTCAAGGCTGGGCATGG - Intergenic
1151476901 17:74349280-74349302 ATTGATGAGCAGACTGGGCGGGG + Exonic
1151546352 17:74795662-74795684 TCAGCTGTGCAGGCTGGGCTGGG - Intronic
1152003479 17:77662131-77662153 AGCTCTGTGCAGGCTGGGCAGGG + Intergenic
1152251113 17:79213145-79213167 ATTCATGTCCAGGCTGGGCGTGG - Intronic
1152346584 17:79756205-79756227 ACTGGTGTCCCGGCTGGGCGCGG - Intergenic
1152346856 17:79757940-79757962 AATGATTTCCAGGCTGGGCAAGG + Intergenic
1152679784 17:81661095-81661117 ATTGTTTTGTAGGCTGGGCATGG + Intronic
1152813121 17:82391609-82391631 ACTGATGGTCAGGCTGGGCGCGG - Intronic
1152958794 18:64432-64454 GCCTGTGTGCAGGCTGGGCATGG + Intronic
1152985470 18:316931-316953 GCTGGTGTGTAGGCCGGGCACGG + Intergenic
1153286793 18:3463924-3463946 AATAATTTGGAGGCTGGGCACGG - Intergenic
1153294513 18:3532999-3533021 AATAGTGTGCAGGCTAGGCACGG + Intronic
1153395964 18:4621087-4621109 AGAGATGAGGAGGCTGGGCATGG + Intergenic
1153449862 18:5215299-5215321 TCTGTTGTCCAGGCTGGGAAGGG - Intergenic
1153602836 18:6798483-6798505 AATAATTTACAGGCTGGGCATGG - Intronic
1153697947 18:7663557-7663579 ACAGATCTGCAGTCTGGGCAGGG + Intronic
1153871199 18:9321841-9321863 GCTGACCTGCAGGTTGGGCAAGG - Intergenic
1153878238 18:9396012-9396034 ACTGATTTGAAGGCTGGGTCAGG - Intronic
1154139744 18:11812551-11812573 AATGACATTCAGGCTGGGCACGG + Intronic
1154311475 18:13270070-13270092 AGAAATGTGGAGGCTGGGCATGG + Intronic
1155270264 18:24134563-24134585 CCAGATGTCCAGGCCGGGCACGG - Intronic
1155287744 18:24308508-24308530 AGTGATGAGCAGGCCAGGCATGG - Intronic
1155296200 18:24386667-24386689 AATGAAGTACAGGCCGGGCATGG + Intronic
1155498363 18:26464299-26464321 AGTGATGTGCTTGCTGGCCATGG - Intronic
1155959790 18:31984509-31984531 CCTAATGTCCCGGCTGGGCATGG - Intergenic
1156329520 18:36106546-36106568 AATGAGGTTCTGGCTGGGCACGG - Intergenic
1156358267 18:36361393-36361415 AAAGCTGTCCAGGCTGGGCATGG + Intronic
1157342575 18:46792308-46792330 ACTGATGTGCAGCCAGGGCTGGG + Intergenic
1157683050 18:49622011-49622033 ACTGAGGGGAGGGCTGGGCAAGG + Intergenic
1158050572 18:53212960-53212982 ATTGAAAGGCAGGCTGGGCATGG - Intronic
1158495011 18:57947363-57947385 AATAATGTCCAGGCTGGGCACGG + Intergenic
1159324354 18:66894984-66895006 GCTGATGTGAATGCTGGTCATGG + Intergenic
1159349809 18:67258089-67258111 CCTGTTTTGCAGGCTGGGGAGGG + Intergenic
1160036585 18:75307284-75307306 AATGATTTGGTGGCTGGGCATGG + Intergenic
1160206432 18:76837184-76837206 ACTTTTGTGAAGGCTGGGCATGG - Intronic
1160244601 18:77146931-77146953 ACTGATGCCCAGGCTCAGCAGGG - Intergenic
1160269598 18:77372440-77372462 GCTGATGTGGATGCTGCGCATGG - Intergenic
1160812143 19:1017500-1017522 ACTCCTGTGCTGGGTGGGCAGGG - Intronic
1160910993 19:1473749-1473771 ACAGAAGTGCAGGGTGGGAAGGG + Exonic
1160952716 19:1675395-1675417 ACAGGTGGGCAGGCTAGGCAGGG + Intergenic
1161213024 19:3077634-3077656 ATTTATGTGTGGGCTGGGCACGG - Intergenic
1161277106 19:3424671-3424693 AATGAAGTTCAGGCCGGGCACGG - Intronic
1161345469 19:3766946-3766968 GCTGATCTGAAGGCTGGGGAGGG + Intronic
1161527243 19:4764022-4764044 CCTGACCTGCAGCCTGGGCAAGG - Intergenic
1161654430 19:5505278-5505300 AGTGAGGTGGAGGCTGGGCATGG + Intergenic
1161975042 19:7603842-7603864 AAGGCTGTGCAGGCTGGGCGTGG + Intronic
1162353422 19:10165681-10165703 AGGGATGTGAGGGCTGGGCATGG - Intronic
1162357017 19:10192469-10192491 AAGGCTGGGCAGGCTGGGCATGG + Intronic
1162428837 19:10614521-10614543 AGTTATATGCAGGCCGGGCATGG - Intronic
1162569444 19:11462665-11462687 AATCATGTCCATGCTGGGCACGG + Intronic
1162627419 19:11895927-11895949 ACAGATGCCCAGACTGGGCATGG + Intronic
1162904261 19:13814337-13814359 ATGCATGTGTAGGCTGGGCATGG - Intronic
1162973410 19:14194807-14194829 ACTGAGGTGCAAGGTGGGGACGG - Intronic
1163036803 19:14574403-14574425 GCAGCTGTGCAGGCTGTGCACGG - Intergenic
1163065486 19:14789736-14789758 ACAGAAGTGCTGGCCGGGCACGG - Intergenic
1163080133 19:14933368-14933390 ACAGATTTCCAGGCTGGGCATGG - Intergenic
1163120896 19:15217151-15217173 AGTGAATTCCAGGCTGGGCATGG - Intergenic
1163197158 19:15730363-15730385 AATGATATACTGGCTGGGCACGG - Intergenic
1163606630 19:18279528-18279550 GCTGATGTCCAGGTTGGGGAGGG - Intergenic
1163642227 19:18468403-18468425 AGGGAGGTGCAGGCAGGGCAGGG - Intronic
1164012976 19:21223935-21223957 AGTGATGTGTTGGCTGGGCATGG + Intronic
1164028599 19:21378887-21378909 AGTGATGTGTTGGCTGGGCGCGG - Exonic
1164136303 19:22419866-22419888 TTAGATGTGTAGGCTGGGCACGG + Intronic
1164988471 19:32666935-32666957 TCTGATCTCCTGGCTGGGCATGG - Intronic
1165171774 19:33897517-33897539 TCTTATGTACAGGCTAGGCACGG + Intergenic
1165272979 19:34726146-34726168 CCTGATGTCCATTCTGGGCAGGG + Intergenic
1165328120 19:35125910-35125932 AGTGAGGTGCAGGCAGGGGAGGG - Intronic
1165334047 19:35156762-35156784 AGTGAAGTGCAGCCAGGGCAGGG + Intronic
1165570171 19:36769222-36769244 ACTGCAGTCCAGCCTGGGCAAGG + Intronic
1165813782 19:38628532-38628554 TCGCATGTGCTGGCTGGGCATGG + Intronic
1166854051 19:45773931-45773953 ACTAATTTACAGGCTGGGCATGG - Intronic
1166922697 19:46241229-46241251 ACTGAACTCCAGCCTGGGCAAGG + Intergenic
1166929098 19:46290441-46290463 ACAGATCTGCAATCTGGGCAGGG - Intergenic
1167228156 19:48263845-48263867 AATGAAATGCAGGCTGGGCACGG + Intronic
1167337013 19:48892779-48892801 ACTGTTCTGCTGGCTGGGCGCGG - Intronic
1167540039 19:50080129-50080151 ATTAATGTTAAGGCTGGGCACGG + Intergenic
1167629665 19:50617638-50617660 ATTAATGTTAAGGCTGGGCACGG - Intergenic
1167831102 19:52023434-52023456 ACTCTTGAACAGGCTGGGCATGG - Intronic
1167857503 19:52254531-52254553 ACAGCTGGGCAGGCCGGGCATGG - Intergenic
1168143497 19:54405371-54405393 AGTGCAATGCAGGCTGGGCATGG + Intergenic
1168234008 19:55050576-55050598 ACAGACGTGCTAGCTGGGCATGG - Intronic
1168281355 19:55307267-55307289 ACTAACATGCAGGCTGGGCGCGG + Intronic
1168293513 19:55368507-55368529 ACTCATGGCCAGGGTGGGCAGGG + Exonic
925104728 2:1281792-1281814 ACAAATGTTCAGGCAGGGCAAGG - Intronic
925438980 2:3867681-3867703 AGTGAAGTGCAGGCTGGCTAGGG + Intergenic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
927057409 2:19378569-19378591 ACTGATGTCCAGGCTAGGGATGG + Intergenic
927211453 2:20641464-20641486 GATCACGTGCAGGCTGGGCAGGG - Intronic
927645733 2:24875644-24875666 ACTGACGTGCAGCCTGGGTGGGG + Intronic
927706173 2:25297803-25297825 CCAAATGTGCAGGCTGGGCCAGG - Intronic
928173399 2:29017900-29017922 GCTGATGGGGATGCTGGGCAGGG - Exonic
928866940 2:35928327-35928349 AGTGAGATGTAGGCTGGGCATGG - Intergenic
929653584 2:43706905-43706927 AATCATATGCTGGCTGGGCACGG + Intronic
929759527 2:44795603-44795625 AAAAGTGTGCAGGCTGGGCACGG + Intergenic
929844697 2:45511115-45511137 ACTGAATTGCAGGCTGTACAAGG + Intronic
930053222 2:47233170-47233192 ACTGATGTACAGGAAGGTCAAGG + Intergenic
930180773 2:48354309-48354331 AGTGCTGTGCTGGCTGGGCGCGG + Intronic
930252341 2:49048790-49048812 ATTGCTGTGTAGGCTGGCCAGGG + Intronic
930776333 2:55174901-55174923 AATGAGCTGCTGGCTGGGCAAGG - Intronic
931059348 2:58509260-58509282 AGGGATGTGCATGCAGGGCAGGG + Intergenic
931170837 2:59802165-59802187 ACTGATGGACAAGCTAGGCAAGG - Intergenic
931436188 2:62249141-62249163 TATGGTTTGCAGGCTGGGCATGG - Intergenic
931751141 2:65331115-65331137 AATGCTGTCCAGGCTGGGCGTGG + Intronic
932296607 2:70629116-70629138 AATGAAATGAAGGCTGGGCATGG + Intronic
932967369 2:76492391-76492413 ACAGACAAGCAGGCTGGGCACGG - Intergenic
933667764 2:84978285-84978307 ACTGCTGCTAAGGCTGGGCACGG - Intronic
933707055 2:85299257-85299279 ACTGATGCAGAGGCTGGGCGTGG + Intronic
934864553 2:97794324-97794346 ATTCATGAGCAGGCCGGGCACGG - Intronic
934901291 2:98161997-98162019 ATAGATGGGCAGGCTGGGCACGG - Intronic
935146387 2:100398336-100398358 CCCGATCGGCAGGCTGGGCAAGG + Intronic
935150617 2:100431787-100431809 ACTTTTTGGCAGGCTGGGCATGG + Intergenic
936315823 2:111423265-111423287 AGTGATGTTGTGGCTGGGCACGG - Intergenic
936418743 2:112344379-112344401 ACAGATGTGCAGGCTGAACTGGG + Intergenic
936513229 2:113165139-113165161 GCTGCTGTGGAGCCTGGGCAGGG + Intronic
936548022 2:113409496-113409518 ACTGTTGTGCGGCCTGGGAAGGG + Intergenic
936561772 2:113544916-113544938 ATTGCTTTGTAGGCTGGGCATGG - Intergenic
936767530 2:115871734-115871756 ACTGAGGTGCAGGCCAGGCACGG + Intergenic
936805063 2:116321393-116321415 AATGATATGAAGGCTGGGAAAGG + Intergenic
936962323 2:118088685-118088707 ACTGATGGGCCTGCAGGGCAAGG + Intronic
937187026 2:120053775-120053797 GCTGCTCTGAAGGCTGGGCATGG + Intronic
937251621 2:120527602-120527624 TCTGATGTGCAGGCTGGGGGTGG + Intergenic
937398239 2:121557790-121557812 TATTATGTGTAGGCTGGGCACGG + Intronic
937863635 2:126732058-126732080 AAGGAAGGGCAGGCTGGGCATGG + Intergenic
938450130 2:131411143-131411165 ACAAATGTGCAGGATGTGCAGGG - Intergenic
938906234 2:135838681-135838703 CCTTATATACAGGCTGGGCATGG + Intergenic
939615211 2:144354694-144354716 ACTGATTTGCAGGCTTGGAGAGG + Intergenic
939928856 2:148207113-148207135 AAGGATGTGCAGGAGGGGCAAGG + Intronic
940003557 2:148991047-148991069 GCTGATGTACAGGCGGGCCATGG - Exonic
940056254 2:149515302-149515324 ACTGATGTGCAGGCCGGGAGCGG - Intergenic
940314917 2:152318723-152318745 ACTGATGTTGAGGCCGGGCACGG + Intergenic
940605271 2:155916017-155916039 ACTGAAAACCAGGCTGGGCACGG + Intergenic
940773511 2:157863301-157863323 ACTGTTCTATAGGCTGGGCATGG - Intronic
941599047 2:167516891-167516913 ACCTATGTGGAGGCTGGTCACGG - Intergenic
941780587 2:169440390-169440412 TCTGATGACTAGGCTGGGCACGG + Intergenic
941921713 2:170857453-170857475 AGTGTTTTTCAGGCTGGGCATGG + Intronic
942172642 2:173302890-173302912 TAAGATGTGGAGGCTGGGCACGG + Intergenic
942658535 2:178239915-178239937 AATGAAGTTCAGGCTGAGCACGG - Intronic
943340285 2:186672238-186672260 AATGAAGTACTGGCTGGGCATGG - Intronic
943356449 2:186862017-186862039 ACGGATGTATAGGTTGGGCATGG + Intergenic
943695425 2:190924624-190924646 ATGGATGTGTCGGCTGGGCACGG + Intronic
943707770 2:191053836-191053858 ACTGTTCTCCGGGCTGGGCACGG + Intronic
943884551 2:193199414-193199436 ACTGATTTGCAGGCTGCTCTTGG - Intergenic
944792207 2:203142444-203142466 ACTGATGCCCAGGCTGGGCATGG - Intronic
944868012 2:203881126-203881148 ACTTATGGGGAGGCTAGGCAGGG + Intergenic
945790574 2:214299535-214299557 ACAGAAGTATAGGCTGGGCACGG - Intronic
945853983 2:215045322-215045344 ACTGATATGCAGGCTTGGAAAGG + Intronic
945957163 2:216097243-216097265 ATTATTGTGGAGGCTGGGCACGG + Intronic
946410671 2:219513717-219513739 ACAGATATGCAAGCTGGCCAGGG + Intergenic
946711938 2:222515617-222515639 AAATATGTTCAGGCTGGGCACGG - Intronic
946783685 2:223220069-223220091 ACTGTGGTTCAGGGTGGGCAGGG + Intergenic
947084756 2:226438376-226438398 AGTGAGTGGCAGGCTGGGCATGG + Intergenic
947306378 2:228752978-228753000 ACTTAAGACCAGGCTGGGCATGG + Intergenic
947608008 2:231502012-231502034 AGTGTGGTGCAGGCTGGGCATGG - Intergenic
947617510 2:231568030-231568052 AATGAGATCCAGGCTGGGCACGG - Intergenic
947812532 2:233013407-233013429 TCTGAGGGGAAGGCTGGGCATGG + Intronic
948247367 2:236498154-236498176 AATGAGGTGCAGGCTGGGCGTGG + Intronic
948428438 2:237902693-237902715 TCTGATGTGCAGGCAGGGCTGGG - Intronic
948663811 2:239522440-239522462 AGTGGGGTGCAGGCTGGGGAAGG - Intergenic
948838357 2:240637001-240637023 AGTCATGGGCAGGCTGGGCATGG - Intergenic
948923457 2:241078821-241078843 AGTTATGTGCAGGCCAGGCACGG + Intronic
1168780826 20:488293-488315 ACTGATGTGCAGGCTGGGCACGG - Intronic
1168939874 20:1700218-1700240 AAAAATGTCCAGGCTGGGCATGG + Intergenic
1169622804 20:7526921-7526943 AATAATGTGCAGGCCGGGCGCGG - Intergenic
1170839075 20:19909152-19909174 ACTGAAGAGCAGACTGGGCGCGG - Intronic
1170910154 20:20558294-20558316 AGTGCTGTGCAGGCTGGGCGCGG - Intronic
1170940556 20:20844930-20844952 ACAGATGAACAGGCCGGGCACGG - Intergenic
1171425906 20:25048524-25048546 TCTGATGTGCAGCCAGGGCTGGG + Intronic
1172102114 20:32491185-32491207 CCTGATCTGCATGCTGGTCATGG + Intronic
1172387811 20:34546399-34546421 AAGGTTGTGGAGGCTGGGCATGG + Intergenic
1172774286 20:37398099-37398121 CCTGCTGTGTAGGCTGGGCCCGG + Intronic
1172786210 20:37470382-37470404 AGGGTTGTGCAGGCTGGGCGCGG + Intergenic
1172786542 20:37472462-37472484 ATCGAAGTTCAGGCTGGGCATGG + Intergenic
1173195981 20:40913207-40913229 ACTAGTGAGCAGGCTGGGCTAGG - Intergenic
1173343672 20:42178224-42178246 ACAGATCTTCTGGCTGGGCACGG - Intronic
1173696613 20:45021107-45021129 ATTCTTGTGTAGGCTGGGCATGG - Intronic
1173960290 20:47066047-47066069 ATTGTTTTGCTGGCTGGGCATGG + Intronic
1174066055 20:47866847-47866869 ACTGAGGTGGAGGCTGAGCAGGG - Intergenic
1174080196 20:47965505-47965527 AGTGATTTTCAGGCTGGGCACGG - Intergenic
1174157961 20:48528818-48528840 ACTGTGGTGGAGGCTAGGCAGGG + Intergenic
1174498045 20:50963215-50963237 AATCAAGTTCAGGCTGGGCATGG - Exonic
1174548902 20:51346770-51346792 ACAAATATGCAGTCTGGGCAAGG + Intergenic
1174643214 20:52063145-52063167 AAAGTTTTGCAGGCTGGGCATGG + Intronic
1174644928 20:52077454-52077476 TCTGATGTTAAGGCTGGGCATGG - Intronic
1175024673 20:55889192-55889214 ACTGGGGTTTAGGCTGGGCACGG + Intergenic
1175104139 20:56602279-56602301 ACAATTGTGGAGGCTGGGCACGG - Intergenic
1175830861 20:61965118-61965140 AACGGTGTGCAGGCAGGGCAGGG - Intronic
1175868383 20:62193947-62193969 ACAAATGCGGAGGCTGGGCACGG + Intronic
1176009404 20:62884629-62884651 ACTGATGGACAGGCTGAGCACGG + Intronic
1176016425 20:62936120-62936142 CTTGACGTTCAGGCTGGGCATGG + Intronic
1176284631 21:5012832-5012854 GCTGCTGTGCAGTCCGGGCAGGG + Intergenic
1176297519 21:5082108-5082130 ACGCATGTGCAGTTTGGGCAGGG + Intergenic
1176427161 21:6555339-6555361 ATTTATTTGTAGGCTGGGCACGG + Intergenic
1177653354 21:23985644-23985666 ACTGAACTCCAGCCTGGGCAAGG + Intergenic
1177671109 21:24228945-24228967 ACTGAAGTGGAGGCTTGGCCAGG + Intergenic
1178021351 21:28412034-28412056 ACAAATGTCCAGTCTGGGCAAGG - Intergenic
1178424612 21:32469334-32469356 AGTGATGGGCATGCTGGGCTTGG + Intronic
1178536739 21:33416150-33416172 ACTACTATGAAGGCTGGGCACGG - Intronic
1178575655 21:33787142-33787164 ACTGAATTACAGGCTGGACAAGG + Intronic
1178697872 21:34809620-34809642 CCTGCAGTCCAGGCTGGGCATGG + Intronic
1178897467 21:36571128-36571150 AAGGAGATGCAGGCTGGGCACGG - Intronic
1178989811 21:37343434-37343456 AAAGATGGGGAGGCTGGGCATGG - Intergenic
1179506771 21:41846411-41846433 AATGTTCTGCAGGCTGGGCACGG + Intronic
1179702652 21:43163657-43163679 ATTTATTTGTAGGCTGGGCACGG + Intergenic
1179859510 21:44179840-44179862 ACGCATGTGCAGTTTGGGCAGGG - Intergenic
1179872550 21:44250643-44250665 GCTGCTGTGCAGTCCGGGCAGGG - Intronic
1180045160 21:45301796-45301818 ACTCAGGGGCAGGCTCGGCAGGG + Intergenic
1180679224 22:17613008-17613030 ATTAAACTGCAGGCTGGGCAAGG - Intronic
1182148756 22:28013909-28013931 TCTGTTGGGCAGGCTGGGAAGGG + Intronic
1182215517 22:28713969-28713991 ACAAGTGTCCAGGCTGGGCACGG - Intronic
1182240228 22:28910329-28910351 TCTGATGGAGAGGCTGGGCATGG - Intronic
1182507065 22:30791260-30791282 AGAGATGTGTTGGCTGGGCATGG - Intronic
1183208692 22:36436493-36436515 ACTAAAGTGGAGGCCGGGCATGG + Intergenic
1183433135 22:37777936-37777958 AAAGATGTCCAGGCCGGGCACGG - Intergenic
1183604303 22:38859769-38859791 ACTCATGGGCTCGCTGGGCACGG + Intergenic
1183826147 22:40389307-40389329 ACTGCAGTGCAGGCCGGGCGCGG + Intronic
1183858959 22:40655177-40655199 ACAGATTTGCTGGCTGGGTACGG + Intergenic
1184567614 22:45301567-45301589 ACTGCAGTACAGGGTGGGCAGGG - Intergenic
1184591931 22:45490728-45490750 ACTGATGTCCAGGCCGGGTGAGG - Intergenic
1184638206 22:45852818-45852840 TCTGAAGGGCTGGCTGGGCAGGG - Intergenic
1184825081 22:46944686-46944708 AATGGAGTACAGGCTGGGCACGG - Intronic
949333395 3:2946998-2947020 ACAGAAATGCAGGCTGGCCAGGG - Intronic
949475352 3:4439941-4439963 GATGCTGAGCAGGCTGGGCATGG + Intronic
949549358 3:5099435-5099457 ATTAAAATGCAGGCTGGGCACGG - Intergenic
950178761 3:10896090-10896112 CCTGCAGTGAAGGCTGGGCAGGG + Intronic
950212805 3:11136386-11136408 ACTGAGGTGCAGGCTGTGTGTGG - Intergenic
950437427 3:12988667-12988689 TCTGAGGAGCAGGCTGGGGAGGG + Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951715472 3:25639594-25639616 ACAAATGTGGAGGCTGGGCGCGG - Intronic
952194962 3:31065675-31065697 ACTGAGGTGCAGCCTGGGCATGG + Intergenic
952313376 3:32210566-32210588 AAAGAAGTCCAGGCTGGGCACGG - Intergenic
952387247 3:32850924-32850946 CCTGAGGTGCAGGTTGGGGAGGG + Intronic
952446690 3:33387776-33387798 TCAGGTTTGCAGGCTGGGCACGG + Exonic
952959502 3:38580666-38580688 ACTCATGCCCTGGCTGGGCATGG - Intronic
953277316 3:41514962-41514984 ACAGATATGCTGGCTGTGCATGG + Intronic
953403873 3:42650793-42650815 ACTCGTCTGCAGGCTGGGAAGGG - Intergenic
953435170 3:42872087-42872109 ACTGATAAGCACGCTGGGAAGGG + Intronic
953903390 3:46856105-46856127 GAGGATGTGCAGGCTGGGCGTGG - Intergenic
953933918 3:47023108-47023130 ACTGATTAGAGGGCTGGGCACGG + Intronic
953981083 3:47413309-47413331 ACAGGGGTGCAGGCTGGGCCAGG - Exonic
953992152 3:47492277-47492299 ACAGATCTTCTGGCTGGGCACGG + Intergenic
954284137 3:49606823-49606845 TATTATTTGCAGGCTGGGCACGG + Intronic
954343198 3:49972808-49972830 ACTAAAGTACAGGCGGGGCATGG + Intronic
954356468 3:50086134-50086156 ATTATTTTGCAGGCTGGGCATGG + Intronic
954433096 3:50481703-50481725 AATAAAGTGCAGGCTGGGCATGG + Intronic
954439754 3:50515454-50515476 ACTGAGGGGCAAGCTGGGCCGGG - Intergenic
954589028 3:51764063-51764085 ATTTATGCGCAGGCCGGGCATGG + Intergenic
954902482 3:54031785-54031807 ACTGTGGTGTAGGCTGGGAATGG + Intergenic
955167618 3:56529819-56529841 GCTGAATTGAAGGCTGGGCATGG + Intergenic
955682883 3:61520298-61520320 ATTGAAGTGCTGGCCGGGCACGG - Intergenic
955993993 3:64659175-64659197 ACTTAAATGGAGGCTGGGCACGG + Intronic
957395644 3:79633474-79633496 ACAAATATGTAGGCTGGGCATGG - Intronic
957598197 3:82295624-82295646 ATTGATGTACGGGCCGGGCAAGG - Intergenic
958124139 3:89333581-89333603 ACCTAACTGCAGGCTGGGCAGGG + Intronic
958192855 3:90205312-90205334 TCTTATGTCCAGGCTGGGCACGG - Intergenic
958637927 3:96769193-96769215 ACTGAGATGATGGCTGGGCATGG + Intergenic
958980708 3:100715860-100715882 TCTGAATTGTAGGCTGGGCATGG - Intronic
959543768 3:107570584-107570606 ACTGTTGGGCAGGTTGGGGAGGG + Intronic
959614074 3:108327841-108327863 AATGTTGTAGAGGCTGGGCATGG + Intronic
961056428 3:123792878-123792900 ACTGAATTGCATGCTGTGCATGG - Intronic
961151645 3:124643301-124643323 AATTTTGTGGAGGCTGGGCATGG - Intronic
961186730 3:124921439-124921461 GTTGAGGTGGAGGCTGGGCATGG - Intronic
961210883 3:125124614-125124636 ACAAATGTGCAGGCCAGGCACGG - Intronic
961325081 3:126104926-126104948 TCTGATGGGCAAGCTTGGCAAGG - Intronic
961560550 3:127725773-127725795 AGTAAATTGCAGGCTGGGCAAGG + Intronic
962256695 3:133875568-133875590 ACTGATGTGCAGGCTGGGCCTGG - Intronic
962547411 3:136451471-136451493 AAAGGTATGCAGGCTGGGCATGG + Intronic
963198933 3:142567032-142567054 ACTGTAGTGTTGGCTGGGCACGG - Intronic
963238086 3:142974974-142974996 AGTGCTGGGCAGGCTGGGCATGG + Intronic
963938934 3:151081763-151081785 ACTGTGGTCCTGGCTGGGCATGG - Intergenic
963962450 3:151324111-151324133 AGTGATGTGCACCATGGGCAAGG + Intronic
964956539 3:162365501-162365523 ACTGTAGGGCAGGCTGGTCAGGG - Intergenic
965420706 3:168455033-168455055 AGTGGTATGTAGGCTGGGCATGG + Intergenic
965566072 3:170118911-170118933 ACTGCTGTGAAGGCTGGGCATGG - Intronic
965574692 3:170206181-170206203 AGTAAAGTACAGGCTGGGCACGG + Intergenic
966599567 3:181761686-181761708 AATTATGTGGAGGCCGGGCATGG + Intergenic
966630671 3:182070851-182070873 ACTTAGCTGAAGGCTGGGCACGG - Intergenic
966943083 3:184759210-184759232 ACTCATTTGTAGGCTGGGCGTGG + Intergenic
967965883 3:194959964-194959986 ATAGATGAGGAGGCTGGGCATGG - Intergenic
968320842 3:197766731-197766753 CCTGTACTGCAGGCTGGGCATGG - Intronic
968421800 4:491135-491157 ACTGATTTTGGGGCTGGGCATGG + Intronic
969183207 4:5457503-5457525 ACCCACATGCAGGCTGGGCACGG - Intronic
969311536 4:6355698-6355720 AGTGCTGTGCTGGCCGGGCATGG + Intronic
969399058 4:6941619-6941641 ACAGATGTGCAAGCTGAGGAAGG - Intronic
969570753 4:8006785-8006807 CCTCATCTGCAGGCAGGGCAAGG - Intronic
971239481 4:24875016-24875038 ACTGAGTTAAAGGCTGGGCACGG + Intronic
971411243 4:26375010-26375032 ATTGATGTGAGGGCTGGGCACGG + Intronic
971659427 4:29392998-29393020 AGACATGTGTAGGCTGGGCATGG + Intergenic
972536655 4:40005586-40005608 AAGAATGTGAAGGCTGGGCATGG - Intergenic
972540546 4:40035408-40035430 AAAGAAGTGGAGGCTGGGCATGG + Intergenic
972549350 4:40113880-40113902 AATAAAGTACAGGCTGGGCATGG - Intronic
972598305 4:40549380-40549402 ACTGAGGTACTGGCTGGGCGTGG - Intronic
972813853 4:42622083-42622105 ACTTAAATGAAGGCTGGGCATGG + Intronic
972850338 4:43041350-43041372 ACTGAGGTGCAGGCTTAACATGG + Intergenic
973200455 4:47496025-47496047 AATGATGTTTAGGCTGGGCATGG - Intronic
973240565 4:47952070-47952092 ATCTATGTTCAGGCTGGGCATGG + Intronic
973559055 4:52115903-52115925 ACTTATGTGGAGGCCAGGCATGG - Intergenic
973744633 4:53951064-53951086 ATGGACGTGCAGGCTGGGGACGG + Intronic
973875773 4:55217054-55217076 ACTGAAGTGTAGGCAGGGCTGGG - Intergenic
974038925 4:56841282-56841304 ACTGTTCTTTAGGCTGGGCATGG - Intergenic
974436532 4:61863525-61863547 AATGATGCCCAGGCCGGGCACGG - Intronic
974785132 4:66609708-66609730 TCTGATGTGCAGACTTGGCAGGG - Intergenic
975067061 4:70078911-70078933 AATGAAGTTCAGGCTGGGCGTGG - Intergenic
975676189 4:76830234-76830256 AGTTATGTGAATGCTGGGCACGG - Intergenic
976258930 4:83127531-83127553 ACTGTTTTCCAGGCTGGGCATGG + Intronic
976469161 4:85407262-85407284 ACTGCTGTGGATGCTAGGCAGGG + Intergenic
976738301 4:88333041-88333063 ACTATTATGCTGGCTGGGCATGG - Intergenic
977916271 4:102597633-102597655 ACTGCTGTGCAGGATGAGAATGG + Exonic
978546061 4:109873874-109873896 ACTGATGGGCAGGGAGTGCATGG + Intergenic
979616242 4:122745917-122745939 AGTTATATGCAGGCTGGGCGTGG - Intergenic
980110756 4:128634624-128634646 AATCTTGTCCAGGCTGGGCACGG + Intergenic
980171868 4:129298885-129298907 ACTGGTGTGAAGGCTAGGAAAGG + Intergenic
981110660 4:140929861-140929883 ACTGAGGTTTTGGCTGGGCATGG + Intronic
981195854 4:141919485-141919507 ACTGATCCACAGGCTGGGGAGGG + Intergenic
981396373 4:144254384-144254406 GCTGATAGGCAGGCCGGGCACGG - Intergenic
982255144 4:153444228-153444250 AGGGATGTTGAGGCTGGGCAAGG - Intergenic
982510970 4:156283150-156283172 ACTCAAGTTCAGGCTGGGCGCGG + Intergenic
982934462 4:161453882-161453904 CATAATGTGCAGGCTGGGCATGG - Intronic
983728819 4:170967709-170967731 ACTGACGTGCAGGCCGGGCGCGG + Intergenic
983900605 4:173129261-173129283 ACTGAAGTGAAGGCATGGCAGGG + Intergenic
983926338 4:173406915-173406937 ACAGAGGTGCGCGCTGGGCATGG + Intergenic
984737534 4:183124576-183124598 AAAGATCTGCAAGCTGGGCATGG - Intronic
985088807 4:186342799-186342821 ACTCATCTTTAGGCTGGGCACGG + Intergenic
986098326 5:4582192-4582214 ACTGATGTTCCGTCTGGGCTCGG - Intergenic
986544890 5:8884947-8884969 AGTGATGGGCAGGCAGGGTAGGG + Intergenic
987205898 5:15625361-15625383 ACTGAGCCACAGGCTGGGCACGG + Intronic
989299382 5:39871280-39871302 ACTAATGTTTTGGCTGGGCATGG + Intergenic
989619812 5:43373089-43373111 AAGAATGTTCAGGCTGGGCATGG - Intergenic
989620930 5:43383794-43383816 AGTGACATGCAGGCTGGGCACGG + Intronic
989814591 5:45720973-45720995 AGTGATGTGGAGGCCGGGGAAGG + Intergenic
990200061 5:53361981-53362003 AATGTTGTGTAGGCCGGGCATGG + Intergenic
990204811 5:53417197-53417219 ACTGATATGTAGGCTGGGTGCGG - Intergenic
991430745 5:66542236-66542258 TCTGGGGTGCAGGGTGGGCATGG - Intergenic
992563122 5:77972399-77972421 ACTAATGTGCAGGATGAGAACGG - Intergenic
992632734 5:78697668-78697690 CCTTATGTACAGGCTGGGCATGG + Intronic
993907382 5:93638520-93638542 ATAGAAATGCAGGCTGGGCACGG + Intronic
994273410 5:97808314-97808336 ACTTAAGTGCAGGGTGGGGAAGG + Intergenic
994294729 5:98077372-98077394 AATGATCTGAAGGCTGGGCATGG + Intergenic
994592096 5:101786118-101786140 ACTAATGGGCAGCCTGGGGATGG + Intergenic
995077335 5:108001788-108001810 ACTAATTTTCCGGCTGGGCACGG - Intronic
995188717 5:109298296-109298318 ACTGAGGTGCTGGCTGGGACAGG - Intergenic
995190631 5:109316114-109316136 AACAATGAGCAGGCTGGGCACGG + Intergenic
995223265 5:109675179-109675201 ACCAGTGTGCAGCCTGGGCAAGG - Intergenic
995340008 5:111047939-111047961 ACTAAACTGCAGGGTGGGCAGGG + Intergenic
995567293 5:113444133-113444155 AATGCTGTACAGGCCGGGCACGG - Intronic
995841670 5:116448041-116448063 AGTGCTGTTCAGGCCGGGCACGG + Intronic
996013909 5:118509903-118509925 AAAGACGTGCAGGCTGGGTATGG + Intergenic
996777465 5:127148108-127148130 AATGTGGTGCAGGCCGGGCATGG - Intergenic
997224199 5:132196568-132196590 TCTGATGTTTAGGCTGGGCATGG + Intronic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
997498087 5:134347577-134347599 AATAAAGTGCTGGCTGGGCACGG + Intronic
997806646 5:136924520-136924542 ACTGATATGCAAGATGGGGAGGG + Intergenic
998247705 5:140523396-140523418 AGTTATATGCAGGCTGGGCATGG - Intronic
998249517 5:140542401-140542423 ACAGAAGTGGAGGCCGGGCATGG + Intronic
999117748 5:149178628-149178650 ACTGATGTGCTGCCTGCACATGG - Intronic
999738727 5:154532897-154532919 AGAGATGACCAGGCTGGGCATGG + Intergenic
999914180 5:156239107-156239129 TCAGATTTGGAGGCTGGGCATGG + Intronic
999983129 5:156976890-156976912 ATAGATATGAAGGCTGGGCATGG - Intergenic
1000081605 5:157853484-157853506 ACTGCTTTGTAGGCCGGGCACGG + Intronic
1000155336 5:158545581-158545603 ACACATGAGCAGGCTGGGCACGG - Intergenic
1000222128 5:159224248-159224270 GCTGATGGACTGGCTGGGCACGG - Intergenic
1000752579 5:165114961-165114983 ACTGATGATCAGGCCGGGTACGG - Intergenic
1001327243 5:170738034-170738056 TCTGATGTGCAGCCAGGGCAGGG - Intergenic
1001535022 5:172492188-172492210 ACTGCTGTGCAGCCTGGGGTTGG + Intergenic
1004026023 6:11819281-11819303 AAAGATCTGCAGCCTGGGCATGG - Intergenic
1004212044 6:13658316-13658338 ACCGCTCAGCAGGCTGGGCATGG + Intronic
1004365365 6:15008317-15008339 AATGCAGTTCAGGCTGGGCATGG - Intergenic
1004683868 6:17922912-17922934 ACATATGTGCAGGCTGGGTGTGG - Intronic
1004972210 6:20923209-20923231 AGTTATATGTAGGCTGGGCATGG - Intronic
1005011812 6:21342955-21342977 ACTGCTGTGCAGGGTGGGACAGG - Intergenic
1005267177 6:24124554-24124576 ACTTTTATGCAGGCTGGGAAGGG + Intergenic
1005340785 6:24841906-24841928 ACTGTTTTCCTGGCTGGGCATGG - Intronic
1005628555 6:27686227-27686249 AAAGATGTACAGGCCGGGCACGG + Intergenic
1005820242 6:29592672-29592694 ACCAATGTGGAGGCCGGGCACGG + Intronic
1005975695 6:30796998-30797020 AATGATGTGCAGGCGGGGCGTGG - Intergenic
1006483538 6:34318851-34318873 AAGCATGTACAGGCTGGGCATGG - Intronic
1006525921 6:34605014-34605036 ACTACTGGTCAGGCTGGGCACGG + Intronic
1006546008 6:34782039-34782061 AATGAAGTGCAGGCTGGGCACGG - Intergenic
1006698538 6:35952723-35952745 ACTGATGGGTAGGCTGAGCGCGG + Intronic
1006802469 6:36767952-36767974 TCTGGAGTGCAAGCTGGGCATGG + Intronic
1006929932 6:37681362-37681384 ACTTATGTCCAGCCTGGGTATGG - Intronic
1007090597 6:39182205-39182227 AATGATTTGCAGGCTGGGAAGGG - Intergenic
1007106165 6:39284637-39284659 ACTGAAGTCCAGGGAGGGCAGGG + Intergenic
1007538275 6:42615766-42615788 AATGCTGTGTTGGCTGGGCATGG + Intronic
1007645946 6:43381203-43381225 AATGATGTGTTGGCCGGGCACGG - Intergenic
1007728188 6:43929513-43929535 AGGGATGAGCAGGCTGGGAAGGG + Intergenic
1007754715 6:44091691-44091713 AATGCTGTGCAGGCTGGGCACGG - Intergenic
1007837958 6:44690603-44690625 ACTGATCTGAAGGCTGGGCATGG + Intergenic
1008471970 6:51894395-51894417 CCTCAGCTGCAGGCTGGGCAGGG + Intronic
1008618516 6:53249152-53249174 ACTAACATGAAGGCTGGGCACGG + Intergenic
1008625964 6:53316678-53316700 AGAGATGTCCAGGGTGGGCAAGG + Intronic
1008727742 6:54442121-54442143 ACTGATGCGGAAGCAGGGCAGGG - Intergenic
1008883933 6:56411311-56411333 ATGGATGTGTGGGCTGGGCATGG + Intergenic
1009421067 6:63465470-63465492 ATAGATGTGCAGGCTGAGCATGG - Intergenic
1009963734 6:70555541-70555563 ACTGATTTCCAGGCTGGGCGAGG - Intronic
1010484178 6:76390028-76390050 AAAGATGTTGAGGCTGGGCACGG - Intergenic
1010837458 6:80607847-80607869 AATGAAGTGCTGGCTGGCCATGG - Intergenic
1012638085 6:101572884-101572906 ACTGCAGTGCAGCCTGGGCCTGG - Intronic
1013222247 6:108088857-108088879 CTTGTTGTTCAGGCTGGGCATGG + Intronic
1013290345 6:108714044-108714066 AATGATGTCCAGTCTGGGAAGGG + Intergenic
1013437402 6:110124614-110124636 ACAGATGTACTGGCTGGGTATGG + Intronic
1013515930 6:110885962-110885984 AAAGATTTGCCGGCTGGGCACGG + Intronic
1013529279 6:111004101-111004123 ATAGATGAGCTGGCTGGGCATGG - Intronic
1013822585 6:114173566-114173588 AATCAAGTGCTGGCTGGGCACGG + Intronic
1014161264 6:118171319-118171341 AGTAAGCTGCAGGCTGGGCATGG - Intronic
1014238548 6:118989250-118989272 AATCATGTCCAGGCTGGGCGCGG - Intronic
1014715930 6:124864170-124864192 ACATAAGTGCAGGCTGGGCGCGG + Intergenic
1015413320 6:132919677-132919699 CCTGAGCAGCAGGCTGGGCAAGG - Intergenic
1015535664 6:134264936-134264958 AGTTAATTGCAGGCTGGGCATGG - Intronic
1015956573 6:138604912-138604934 ATTGTAGTGCAGGCTGGGCGTGG - Intronic
1015966874 6:138703069-138703091 AATGAAATGCAGACTGGGCATGG + Intergenic
1016271923 6:142300454-142300476 TCTGATCTGAAGGCTGGACAGGG - Intergenic
1016524731 6:144988993-144989015 AGTGTTGTGCAGGCAGAGCAGGG - Intergenic
1016723647 6:147333229-147333251 ACTAATTCTCAGGCTGGGCATGG + Intronic
1017068947 6:150555325-150555347 AGAGATGTGCTGGCTGGGCACGG - Intergenic
1017151233 6:151282398-151282420 ATGTATGGGCAGGCTGGGCACGG - Intronic
1017181313 6:151555170-151555192 ACTGAGGTCCAGGCTGGGCACGG - Intronic
1018229947 6:161665933-161665955 TCTGATGTCCATGCTGGGCATGG - Intronic
1018847653 6:167566599-167566621 ATAAATGTGGAGGCTGGGCAGGG + Intergenic
1018988100 6:168653167-168653189 ACTGATGGGCTGCCTGGGCGTGG + Exonic
1019308114 7:345975-345997 ACAGATGGTCAGGGTGGGCAGGG + Intergenic
1019316085 7:387577-387599 ACTGAGGCGCAGGAAGGGCACGG + Intergenic
1019381991 7:728633-728655 GCTGATGTACAGACTGGGTAGGG - Intronic
1019451913 7:1103242-1103264 ACAAGTGTGCATGCTGGGCAAGG + Intronic
1019683682 7:2367756-2367778 ACTGAGTGACAGGCTGGGCATGG - Intronic
1020077592 7:5268656-5268678 ATTGATGTTCAGGCCGGGCATGG + Intergenic
1020104484 7:5415669-5415691 AGTCTTATGCAGGCTGGGCACGG - Intronic
1020373824 7:7462566-7462588 ACAGAAATGCAGGCTGAGCACGG + Intronic
1020910749 7:14127451-14127473 TCTGATGTGTAGGTTGGCCATGG + Intergenic
1022306299 7:29149482-29149504 ATGGATTTCCAGGCTGGGCACGG - Intronic
1023564460 7:41509847-41509869 GCTGAGGACCAGGCTGGGCATGG - Intergenic
1023976875 7:45037041-45037063 ACTGATGTGCAGCCGCAGCAAGG - Intronic
1024186403 7:46952353-46952375 AGTCATTTGTAGGCTGGGCATGG - Intergenic
1024432408 7:49303993-49304015 ATTCATATGGAGGCTGGGCATGG - Intergenic
1024799286 7:53057673-53057695 TCTGATGGGGAGCCTGGGCAGGG - Intergenic
1025201537 7:56965019-56965041 ATTGATGTTCAGGCCGGGCATGG - Intergenic
1025670407 7:63611911-63611933 ATTGATGTTCAGGCCGGGCATGG + Intergenic
1026150810 7:67786694-67786716 ACTGTTGTGCACTCTGGGAATGG - Intergenic
1026433015 7:70366992-70367014 ACTGATTTATGGGCTGGGCATGG + Intronic
1026510536 7:71023811-71023833 ACAAATGTTCCGGCTGGGCACGG + Intergenic
1026624515 7:71980478-71980500 TCTGATGTGTTGGCTGGGCGTGG - Intronic
1026797021 7:73372745-73372767 ACTTATTTTCAGGCTGGGCGTGG + Intergenic
1026917300 7:74128531-74128553 ATTCATGTGGAGGCTGGGCATGG - Intergenic
1027164106 7:75822541-75822563 ACTGAGGTTCAGGCTGGGCATGG + Intronic
1027251101 7:76399301-76399323 ACTGTGCTTCAGGCTGGGCACGG - Intronic
1027365402 7:77452427-77452449 ACATATGTCCAGGCCGGGCATGG - Intergenic
1028145323 7:87314474-87314496 ACTGACCTTGAGGCTGGGCACGG + Intergenic
1028895730 7:96039715-96039737 ACTGAGGTGCAGGCAGTGAAGGG - Intronic
1028915334 7:96252801-96252823 ATGAATGGGCAGGCTGGGCACGG + Intronic
1029486966 7:100849215-100849237 AGGGAAGTGAAGGCTGGGCACGG - Intronic
1029620625 7:101688118-101688140 AGGGATGTCCAGCCTGGGCAGGG - Intergenic
1029806250 7:103000215-103000237 AGTCATGTTCAGGCTGGGCATGG + Intronic
1029837497 7:103328338-103328360 ATTCAGGTGTAGGCTGGGCATGG + Intronic
1030685061 7:112477487-112477509 AACTATGTTCAGGCTGGGCACGG - Intronic
1030715723 7:112804613-112804635 AATAATGAACAGGCTGGGCACGG - Intergenic
1030895246 7:115051878-115051900 TATGAAGTGTAGGCTGGGCATGG + Intergenic
1032081631 7:128861645-128861667 AAGGATCTGCAGGCTGGGCGCGG - Intergenic
1032137373 7:129292474-129292496 AATGATGTTAAGGCTGGGCACGG + Intronic
1032264042 7:130358287-130358309 ACACATATGCAGGTTGGGCATGG - Intronic
1032423205 7:131799866-131799888 CCAGATGTCCAGGCTGGGCCTGG + Intergenic
1033140931 7:138825894-138825916 ACAGATTTTCAGGCTGGGCATGG + Intronic
1033171143 7:139085720-139085742 ACAGTGGTTCAGGCTGGGCATGG + Intronic
1033323409 7:140360441-140360463 TCAGATATGGAGGCTGGGCACGG + Intronic
1034566358 7:151918818-151918840 TCTGATGTGCCGGCATGGCAAGG + Intergenic
1034901815 7:154912547-154912569 AATGTGGAGCAGGCTGGGCACGG + Intergenic
1035186984 7:157134075-157134097 AAAGATTTTCAGGCTGGGCATGG - Intergenic
1036083074 8:5579683-5579705 ATTCATGTTCAGGTTGGGCACGG + Intergenic
1036442589 8:8794436-8794458 ACTCATGTGGAGGCCGGGCCAGG - Intronic
1037365370 8:18116324-18116346 ACAAATATGCAGGCTGGGCGCGG - Intergenic
1037453912 8:19044892-19044914 AGTAATGTCCAGGCTGGGCATGG + Intronic
1038770912 8:30478786-30478808 AATCCTGTGCTGGCTGGGCAGGG - Intronic
1038797450 8:30722433-30722455 ATGCATGTTCAGGCTGGGCACGG + Intronic
1038945463 8:32354600-32354622 AAATATGTGCAGGCTGGGCGTGG + Intronic
1039043075 8:33426193-33426215 AGTGATCTTCAGGCTGGGCATGG - Intronic
1039294669 8:36137490-36137512 ACTTAACTGTAGGCTGGGCATGG + Intergenic
1039560001 8:38505087-38505109 ACTGATGTTTGGGGTGGGCAGGG + Intergenic
1039606525 8:38885140-38885162 AAAAATGTGCAGGCCGGGCATGG - Intergenic
1039698265 8:39935738-39935760 AGTAATGCACAGGCTGGGCAAGG - Intronic
1040892529 8:52332560-52332582 ACTAAAATGCAGGCCGGGCACGG + Intronic
1041039013 8:53827089-53827111 AATAAAATGCAGGCTGGGCATGG + Intronic
1041098387 8:54372438-54372460 ACAGACATGCAGGCTGGGCGTGG + Intergenic
1041263539 8:56042589-56042611 ACTTCTGTCCTGGCTGGGCAAGG + Intergenic
1041466169 8:58159603-58159625 AACTATTTGCAGGCTGGGCACGG + Intronic
1041486336 8:58381584-58381606 ACAGAGGTGGAGGCTGGGAAAGG - Intergenic
1042006396 8:64184454-64184476 TATGTTTTGCAGGCTGGGCATGG - Intergenic
1042921277 8:73922336-73922358 ACTGATGGGTAGGCCAGGCATGG - Intergenic
1043823073 8:84892317-84892339 ACTGATTTCCTGGCTGGGCATGG + Intronic
1044264675 8:90167423-90167445 ACTATGGTCCAGGCTGGGCATGG + Intergenic
1044558479 8:93589936-93589958 AATGAAGCCCAGGCTGGGCATGG + Intergenic
1044718315 8:95121788-95121810 ACTGAGGTGCAGGCCAGGCGTGG + Intergenic
1045136242 8:99221862-99221884 GCTGAGGTACTGGCTGGGCATGG - Intronic
1045508071 8:102792750-102792772 TCTGATGTGGAGCCTGGCCATGG - Intergenic
1045652809 8:104357217-104357239 AGTGATATGGGGGCTGGGCATGG - Intronic
1046246687 8:111572781-111572803 AAGTATATGCAGGCTGGGCATGG - Intergenic
1046320797 8:112571576-112571598 GCAGAAATGCAGGCTGGGCATGG + Intronic
1046943388 8:119952846-119952868 TCTGATATGCAGGCTGGTGAAGG + Intronic
1046958867 8:120088685-120088707 ACTAAAGTGAAGGCCGGGCACGG - Intronic
1047240919 8:123087005-123087027 ACAGGTGCCCAGGCTGGGCATGG - Intronic
1047245521 8:123140067-123140089 ACTAATGTATAGGCTGGACATGG + Intronic
1047339078 8:123962916-123962938 ACTGAGTTTCTGGCTGGGCACGG - Intronic
1047411322 8:124626959-124626981 CCCTGTGTGCAGGCTGGGCAGGG - Intronic
1047491336 8:125377129-125377151 ACTGCTCTCCAGGCTGGGCTGGG - Intergenic
1048004082 8:130404565-130404587 ACTGAGGAGCAGGCTGGGAGAGG - Intronic
1048794751 8:138139480-138139502 ACTCATCTGTTGGCTGGGCATGG + Intronic
1048987533 8:139742734-139742756 TCTGATCTGCAGGCTGGGTGGGG + Intronic
1049362074 8:142216595-142216617 ACTGGTCAGCAGCCTGGGCACGG + Intronic
1049579382 8:143404503-143404525 ACTGAGGTGGGGGATGGGCATGG - Intergenic
1049785038 8:144446475-144446497 ACAGGTGTGCAGGCTTGGCCTGG - Intergenic
1049890909 9:70396-70418 ATTGCTTTGTAGGCTGGGCATGG + Intergenic
1050751264 9:8940582-8940604 AGAGATGTGCAGGCTGGGTGCGG - Intronic
1051427155 9:16943834-16943856 ATTCATTTGAAGGCTGGGCACGG + Intergenic
1052856230 9:33408236-33408258 CCTGGGGTGCAGGCTGGGCCAGG + Intergenic
1053242993 9:36511717-36511739 ATAGAAATGCAGGCTGGGCATGG - Intergenic
1053446320 9:38155861-38155883 AGTGATTAGAAGGCTGGGCACGG - Intergenic
1053732372 9:41071596-41071618 ATTGCTTTGTAGGCTGGGCATGG + Intergenic
1053797383 9:41738991-41739013 ACTGCAGTTCAGCCTGGGCAAGG + Intergenic
1053834983 9:42125906-42125928 AATGGAGTTCAGGCTGGGCACGG - Intronic
1053837238 9:42152721-42152743 ACTAAAGTGCAGGCCGGGCGCGG + Intergenic
1054147808 9:61575943-61575965 ACTGCAGTTCAGCCTGGGCAAGG - Intergenic
1054185799 9:61951058-61951080 ACTGCAGTTCAGCCTGGGCAAGG + Intergenic
1054467550 9:65507030-65507052 ACTGCAGTTCAGCCTGGGCAAGG - Intergenic
1054595549 9:67061623-67061645 AATGGAGTTCAGGCTGGGCACGG + Intergenic
1054652713 9:67637447-67637469 ACTGCAGTTCAGCCTGGGCAAGG - Intergenic
1054696079 9:68360121-68360143 ATTGCTTTGTAGGCTGGGCATGG - Intronic
1055506103 9:76951039-76951061 ACAATTGTGTAGGCTGGGCATGG + Intergenic
1056162995 9:83916320-83916342 ACACATGTACAGGCTGGGCACGG - Intronic
1056526398 9:87446867-87446889 ACTGAGGGGCAGGGTGGGGATGG - Intergenic
1056717992 9:89048969-89048991 AATGATATGCCGGCCGGGCACGG + Intronic
1057212922 9:93210289-93210311 AGGGATGGGCAGGGTGGGCAGGG + Intronic
1057323223 9:94033149-94033171 AAGGACGTGCAGGCTGGGGACGG - Intronic
1057403826 9:94749362-94749384 GCTGATTCTCAGGCTGGGCAGGG - Intronic
1057406594 9:94777142-94777164 ACTAATGTTAAGGCTGGGCGGGG + Intronic
1057630246 9:96714223-96714245 ACTGGGATTCAGGCTGGGCACGG + Intergenic
1057946264 9:99331852-99331874 ACTTCTGTCGAGGCTGGGCATGG + Intergenic
1057954899 9:99399719-99399741 CCTGGTGGGCAGGCTGGGCGGGG + Intergenic
1058261824 9:102842921-102842943 ACCGATTTGCAGTCTGTGCATGG + Intergenic
1059488480 9:114646098-114646120 ACTTAGGAGCTGGCTGGGCATGG - Intronic
1059949365 9:119445641-119445663 ATGGCTGTGCTGGCTGGGCATGG - Intergenic
1060225304 9:121786665-121786687 GCTGATGTGGAGGATGAGCAGGG - Intergenic
1060632552 9:125172984-125173006 ACTGAGGAGCCAGCTGGGCACGG + Intronic
1060802846 9:126555624-126555646 AATAAGGTGCAGGCCGGGCATGG + Intergenic
1060841012 9:126793158-126793180 TCTGTTCTGGAGGCTGGGCATGG + Intergenic
1060862486 9:126966226-126966248 ATTCATGTACAGACTGGGCAAGG + Intronic
1060890115 9:127182717-127182739 AAAGATGTTTAGGCTGGGCATGG - Intronic
1060946550 9:127572752-127572774 AATGATATTCAGGCTGAGCACGG + Intronic
1061129966 9:128703132-128703154 ACTGATTTGGAGACTGTGCAAGG - Intronic
1061332957 9:129908493-129908515 ATTCAAGTTCAGGCTGGGCATGG - Intronic
1061333686 9:129914326-129914348 AGTGAAGCGCTGGCTGGGCACGG - Intronic
1061492048 9:130950694-130950716 ACTGATGTGCAACATGGACAGGG + Intergenic
1061532287 9:131224022-131224044 AGTGATTTGGGGGCTGGGCATGG - Intronic
1061918702 9:133770348-133770370 GCTGGTGTGCCGGCTGGGCCGGG + Intronic
1185814174 X:3138890-3138912 TCTTATGAGCAGGCTGGGCACGG + Intergenic
1186488857 X:9955514-9955536 ATTAATATGTAGGCTGGGCAGGG - Intergenic
1186568133 X:10686245-10686267 TCGGGTGTGCTGGCTGGGCAGGG + Intronic
1186881636 X:13872458-13872480 AGTGATATGTAGGCTTGGCATGG - Intronic
1187196296 X:17087884-17087906 ACTGCACTGCAGCCTGGGCAAGG + Intronic
1188501106 X:30826982-30827004 AATCATTTCCAGGCTGGGCACGG - Intergenic
1188511539 X:30941590-30941612 GCTGCTGTGCAGGCAGGGCATGG - Intronic
1188597482 X:31918925-31918947 AAAGATGTTGAGGCTGGGCACGG - Intronic
1189008000 X:37014967-37014989 AGTGATGTGGAGGGTGGCCATGG - Intergenic
1189115884 X:38342301-38342323 AGTGAAATTCAGGCTGGGCATGG - Intronic
1189399976 X:40658380-40658402 ACTGAAGTGCAGGCCGGGTGCGG - Intronic
1189480656 X:41389954-41389976 ACTGATGAGCAGGGTGGGGAGGG + Intergenic
1189993047 X:46612635-46612657 ACTGAGATGCAGGCCGGGCATGG + Intronic
1190859257 X:54328377-54328399 TCAAATATGCAGGCTGGGCACGG + Intronic
1192327333 X:70143899-70143921 GATGATGAGCAGGCTGGGCGCGG + Intronic
1193114011 X:77758096-77758118 TGTGAAGTACAGGCTGGGCACGG + Intronic
1193213351 X:78834824-78834846 AGTGGAGTCCAGGCTGGGCATGG + Intergenic
1195004196 X:100670482-100670504 ATTGCTGTGCAGGCTGCACAGGG - Intronic
1195300728 X:103527641-103527663 TCTGATGTGCATGCTGGTTAAGG + Intergenic
1195822894 X:108966453-108966475 AATGATGGTCAGGCTGGGGATGG - Intergenic
1197404249 X:126029989-126030011 ACTCTTGTGCTGGCAGGGCAAGG + Intergenic
1197475777 X:126923195-126923217 AATAATCTCCAGGCTGGGCATGG + Intergenic
1197790430 X:130248827-130248849 AGTGATGTGGAGGGTGGCCATGG - Intronic
1198246035 X:134832691-134832713 AATGAGATCCAGGCTGGGCACGG - Intronic
1198259928 X:134956674-134956696 AATGGGTTGCAGGCTGGGCACGG + Intergenic
1198811890 X:140544227-140544249 ACACATGTGCAGCCTGAGCAGGG + Intergenic
1199199038 X:145066061-145066083 AATGAACTGAAGGCTGGGCATGG - Intergenic
1199263319 X:145801147-145801169 AAAAATGTACAGGCTGGGCACGG - Intergenic
1200185466 X:154180236-154180258 AATGAAGTGCTGGCCGGGCACGG + Intergenic
1200191120 X:154217376-154217398 AATGAAGTGCTGGCCGGGCACGG + Intergenic
1200202525 X:154292295-154292317 AATGAAGTGCTGGCCGGGCACGG + Intronic
1200789854 Y:7289862-7289884 ATTGATTTTCAGGCTGGGCGTGG + Intergenic
1200958281 Y:8972639-8972661 AATCATGAGGAGGCTGGGCACGG - Intergenic
1201059713 Y:10035415-10035437 ACTGAGCTGCAGGCCAGGCAAGG - Intergenic
1202049237 Y:20763554-20763576 ACTCATGTGCAGGCTCATCACGG - Intronic
1202601575 Y:26598585-26598607 ATTAATTTCCAGGCTGGGCATGG + Intergenic