ID: 1168781595

View in Genome Browser
Species Human (GRCh38)
Location 20:496223-496245
Sequence AGCAGACATCAGGCCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168781595 Original CRISPR AGCAGACATCAGGCCAAATT TGG (reversed) Intronic
900568677 1:3347765-3347787 AGCAGGCATCAGGCCAGATCTGG - Intronic
900739841 1:4324058-4324080 ATTTGAAATCAGGCCAAATTAGG - Intergenic
902930654 1:19728940-19728962 AGCAGCCAGAAGGCCATATTTGG - Intronic
903127021 1:21255148-21255170 AACGGACAACAGGTCAAATTCGG + Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
905652160 1:39663735-39663757 AGCAGACATCTGGCCCAAGCTGG + Intronic
908405724 1:63812254-63812276 AACAGGCCTCAGGCCAAATTTGG - Intronic
911478315 1:98402103-98402125 AGAGGACAGCAAGCCAAATTCGG + Intergenic
912483603 1:110005649-110005671 AGGAGATAGCAGGCAAAATTGGG + Intronic
912572705 1:110636174-110636196 ATCAGTCATCAGCACAAATTGGG + Intergenic
914756518 1:150564808-150564830 AACAGGCAGCAGGGCAAATTTGG + Intergenic
916481420 1:165218097-165218119 AACAGGCATCAGGCCAGATTTGG + Intronic
916925663 1:169517977-169517999 AACAGGCAGCGGGCCAAATTTGG - Intronic
919272777 1:195371334-195371356 AACAGACAACAAGCCAGATTTGG - Intergenic
919772273 1:201170226-201170248 AGCAGGCTTGAGGCCAACTTAGG - Intronic
919974468 1:202601862-202601884 AGCAGAGATGAGGCCAGGTTGGG - Intronic
921224747 1:213007138-213007160 AGCAGAGATCAGGCCAAGTTTGG - Exonic
922251339 1:223851375-223851397 AGCAAACTACAGCCCAAATTTGG + Intergenic
922251341 1:223851388-223851410 AACAGGCAGAAGGCCAAATTTGG - Intergenic
1062889217 10:1045089-1045111 AACAGGCAGCAGGCCAGATTTGG + Intronic
1064433295 10:15289736-15289758 AGCAGGCAGCAGGCCACATTTGG - Intronic
1064669837 10:17701444-17701466 AACAGGCAACAGGCTAAATTTGG - Intronic
1064752136 10:18541253-18541275 AGAAGAAATCAGGGCAAAATGGG + Intronic
1067524828 10:47031901-47031923 AGCAGACAGCAGGCCCAGGTGGG + Intergenic
1067661100 10:48236667-48236689 AGCAGAAAACAGGCCAAGATGGG + Intronic
1068791284 10:61033997-61034019 AGCAGACATCCTGCCAGATCCGG + Intergenic
1071649246 10:87379667-87379689 ATCAGACTTCAGGCCAAAGCTGG + Intergenic
1072283636 10:93893289-93893311 ATCTTACATCTGGCCAAATTAGG + Intergenic
1072512028 10:96137036-96137058 AACAGGCAGCAGGCCAGATTTGG + Intronic
1074144939 10:110709376-110709398 AGCAGACAGCAGGCCATTCTGGG + Intronic
1074496775 10:113986544-113986566 GGCAGAGACCAGGCCACATTAGG - Intergenic
1075320463 10:121487547-121487569 AGCAGAAATCAGTCCCAATGAGG + Intronic
1075349373 10:121710281-121710303 AGGAGACAGCAGGCCAAACAGGG - Intergenic
1075363650 10:121863231-121863253 AGTAGACTTCAGGGCAAAGTTGG - Intronic
1079049222 11:17138806-17138828 AACAGAGAGCAGGCCAGATTTGG + Intronic
1079449660 11:20588956-20588978 GGCAGACATGTGGCCAACTTTGG + Intergenic
1079655662 11:22983724-22983746 AGAAGACATCATTTCAAATTTGG + Intergenic
1080016777 11:27516058-27516080 AGCTGAGATCATGCCAAAGTTGG - Intergenic
1080653076 11:34237971-34237993 ATCACACATCAGGGCAAATGGGG - Intronic
1080992625 11:37557618-37557640 AGCAGACCTGATGCCAAATCTGG + Intergenic
1081266595 11:41031704-41031726 AGCTAAGATCAGGCAAAATTTGG + Intronic
1081938709 11:46922462-46922484 AGCTGAGATCAGGCCAACCTGGG - Intergenic
1082260691 11:50074549-50074571 GGCAGACTTCAGGACAATTTGGG + Intergenic
1082613242 11:55328189-55328211 AGAAGACCTCAGGCCAATTAAGG + Intergenic
1082620364 11:55413108-55413130 AGAAGACGTCAGGCCAATTAAGG + Intergenic
1085085427 11:73663519-73663541 GGTAGACATCAGTCTAAATTGGG + Intergenic
1085607437 11:77914747-77914769 AGCAGGCAACAGGCCAGCTTTGG + Intronic
1086326467 11:85706456-85706478 AGCAGACAGCAGGAGAACTTAGG + Intronic
1087431034 11:98055725-98055747 AGCAGACACCATACCAAATTAGG - Intergenic
1089257707 11:117202608-117202630 AGCAGACAGCAGGCTGGATTTGG - Exonic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1093316114 12:17652170-17652192 ATTAAGCATCAGGCCAAATTTGG - Intergenic
1093607825 12:21114635-21114657 AGCTAATATCATGCCAAATTGGG - Intronic
1094357161 12:29590139-29590161 AACAGGCAGCAGGCCACATTTGG + Intronic
1095284208 12:40389222-40389244 AGCAGACACCCTGCCAAATCTGG - Intergenic
1095632341 12:44392937-44392959 AACAAACATCAGGGCAAATTTGG + Intergenic
1096523193 12:52195549-52195571 AGGAGGCCTCAGGCCAAATGGGG - Intergenic
1097887681 12:64745927-64745949 AAAAGTCATCAGGCCAGATTTGG - Intronic
1100144847 12:91665049-91665071 AGCAGTGAACAGGCCAGATTTGG - Intergenic
1101051551 12:100868944-100868966 AACAGACAGCAGGCCAGATGTGG + Intronic
1101366289 12:104073846-104073868 AAAAGACAGCAGGCCACATTTGG - Intronic
1102033104 12:109754620-109754642 AGCAGCCAGCAGGCCAGATTTGG + Intronic
1102493824 12:113305601-113305623 ATCAGCCCTCCGGCCAAATTTGG + Intronic
1102860301 12:116330473-116330495 GGTAGACATCGGGCCACATTTGG - Intergenic
1103040288 12:117689568-117689590 AACAGTCAGCAGGCCAGATTTGG + Intronic
1103808986 12:123598847-123598869 AGCAGAGATCAAGCCAACCTGGG - Intergenic
1105661616 13:22502119-22502141 TACAGGCATCAGGCCAGATTTGG + Intergenic
1106199208 13:27522514-27522536 AACAGACAACAGGCCAAGTGGGG + Intergenic
1107002288 13:35562302-35562324 AACAGAAATCAGGTCAATTTGGG - Intronic
1107937070 13:45354065-45354087 AACAGAAATAAGCCCAAATTTGG - Intergenic
1108021297 13:46130334-46130356 AGCAGACAACAGGGCAGATCTGG + Intronic
1111436662 13:88219776-88219798 AACAGGCACCAGCCCAAATTGGG + Intergenic
1112376455 13:98846254-98846276 AGCAAAAATCAGGCCAAAGCAGG + Intronic
1112459487 13:99590617-99590639 AGCAGAGACCAGGCGAAACTGGG - Intergenic
1112805450 13:103159663-103159685 TGCAGCCTTCAGGCCAAATCTGG + Intergenic
1113304607 13:109064088-109064110 AGCAGATGGCAGGCCAGATTTGG - Intronic
1113496799 13:110737149-110737171 AGCAGAAATCAGGCCAGGTGTGG - Intergenic
1114075762 14:19160320-19160342 AGCTGACACCAGGCCCTATTTGG - Intergenic
1114086399 14:19239252-19239274 AGCTGACACCAGGCCCTATTTGG + Intergenic
1115448125 14:33515466-33515488 AACAGGCAGCAGGCCAGATTTGG - Intronic
1117713276 14:58554822-58554844 AAAAGACTTCAGGCCAGATTTGG + Intergenic
1118147989 14:63161465-63161487 AACAGGCAGCAGGCCAGATTTGG + Intergenic
1118228542 14:63926588-63926610 AGCAAGCAGCAGGTCAAATTTGG + Intronic
1119574543 14:75707111-75707133 AGCAAAAATCTGGCCCAATTTGG - Intronic
1122921300 14:104881405-104881427 AGCAGACATGGGGCCAAAGCTGG - Intronic
1202897944 14_GL000194v1_random:20871-20893 AGCTGACACCAGGCCCTATTTGG + Intergenic
1125848292 15:42879661-42879683 AACAGTCTGCAGGCCAAATTTGG - Intronic
1128777946 15:70338021-70338043 AGCAGCAAACAGGCCAAATTTGG - Intergenic
1130094276 15:80844440-80844462 AGCAGTCACCTGGCTAAATTTGG - Intronic
1131334309 15:91532930-91532952 ATCAGACATCAGGCAGAATAGGG - Intergenic
1131374084 15:91909270-91909292 AACAGGCAGCAGGCCACATTTGG - Intronic
1132422126 15:101679177-101679199 AGCTGACAACTTGCCAAATTTGG - Intronic
1134555406 16:15159877-15159899 AACAGACAGCAGGCCAGAGTTGG + Intergenic
1134660776 16:15982858-15982880 AGCAGGCAGCAGGCTGAATTTGG + Intronic
1134666199 16:16020455-16020477 AACAGGCAGCAGGCCAGATTCGG - Intronic
1135720010 16:24808374-24808396 AGCAGGCAGTGGGCCAAATTTGG - Intronic
1135845544 16:25915105-25915127 AGCAGACATGTGGCCACATCTGG - Intronic
1136076564 16:27821227-27821249 AGCAGAGATCTGGCCACACTGGG - Intronic
1139206705 16:65035947-65035969 AGCAGACAGAAAGCCAAATTGGG - Intronic
1140141313 16:72260642-72260664 AGCAGAAAGCAGGTCAACTTGGG + Intergenic
1141043719 16:80695110-80695132 AACAAACATCTGGCCAGATTTGG - Intronic
1141713808 16:85715680-85715702 AGCAGGCATCAGGCAGGATTGGG + Intronic
1143280444 17:5750332-5750354 AGCAGACAGGAGGCCAAGGTGGG - Intergenic
1143334846 17:6164594-6164616 AGCAGACCTCAGGAGAAAATCGG + Intergenic
1143336927 17:6178451-6178473 AGCTGACATCAGGGCCTATTGGG - Intergenic
1145262899 17:21365303-21365325 AGCAGAGATCAGGCCCATCTAGG - Intergenic
1146119638 17:30180757-30180779 AACAGGCAACAGGCCAGATTTGG + Intronic
1146631160 17:34470435-34470457 AGCAGGCATCTGGTCAGATTTGG + Intergenic
1149786900 17:59443331-59443353 AACAGGCAGCAGTCCAAATTTGG + Intergenic
1150026865 17:61685242-61685264 AACAGGCAGCAGGCCAAATTTGG + Intronic
1150620012 17:66801154-66801176 GGCAGACATGAAGCCAAACTAGG - Intronic
1150962513 17:69930056-69930078 AGCAGACAGCAGGACCACTTTGG + Intergenic
1153443461 18:5146841-5146863 AACAGACCACAGGCCAGATTTGG + Intronic
1155087897 18:22475413-22475435 AGTAGGCAACAGGCCATATTTGG - Intergenic
1155901097 18:31391634-31391656 AACAGACAGCAAGCCAGATTTGG - Intronic
1156725541 18:40121865-40121887 ATCTGTCATCAGGGCAAATTGGG + Intergenic
1157380235 18:47207898-47207920 TGCAGACATAAGGCAAAAATAGG + Intergenic
1157632266 18:49110037-49110059 AACAGACAACAGGCCAGATTTGG - Intronic
1157901739 18:51524594-51524616 AACAGACAGCAGGCCCAATTTGG - Intergenic
1160712472 19:558914-558936 AACTGACCTCAGGCCAGATTGGG + Intergenic
1162084200 19:8238596-8238618 AGCAGGCACCAGGCCAGAGTTGG + Intronic
1164158663 19:22612098-22612120 AGCAGACACCAGGCCCATGTGGG - Intergenic
1164562999 19:29307028-29307050 ATCAGATATCAAGCCATATTAGG - Intergenic
1165487863 19:36106172-36106194 AGCAGGCATCTGGCCACATGGGG + Intergenic
925192914 2:1899665-1899687 AGCAGAAATCATGCAAAAGTAGG - Intronic
926543409 2:14208932-14208954 AGCAGACAACATGGCATATTAGG - Intergenic
930163439 2:48180795-48180817 AGCAGGCAGCAGGCTGAATTTGG - Intergenic
931904547 2:66828407-66828429 AGCAGACATCAAGCTGAATTTGG + Intergenic
934035137 2:88082829-88082851 AGGACACAGAAGGCCAAATTAGG + Intronic
934648806 2:96075576-96075598 AGCAGGCAGCAGGTCAAATTTGG + Intergenic
934862672 2:97777417-97777439 AACAGACTGCAGGCCAGATTTGG - Intronic
935840717 2:107106619-107106641 AGCAGACAGCAGGCCTCATGTGG - Intergenic
938490351 2:131757819-131757841 AGCTGACACCAGGCCCTATTTGG - Intronic
940413724 2:153396077-153396099 ATCAGGCAGCAGGCTAAATTTGG + Intergenic
941078020 2:161028579-161028601 AGCACACAACAGACCTAATTTGG + Intergenic
941395555 2:164968856-164968878 AGCAGACATCCTTCCAGATTCGG + Intergenic
941494957 2:166188399-166188421 TGCAAGCACCAGGCCAAATTAGG + Intergenic
941677483 2:168359241-168359263 AACAGACAGCAAGCCAGATTAGG - Intergenic
942597691 2:177607918-177607940 AGCAGACATTAGGGCTAAGTGGG + Intergenic
942615958 2:177792607-177792629 AGGAGAGATCAGGCCTAGTTTGG + Intronic
942694759 2:178629157-178629179 AGCAGAAATCAGGCTAAAGGCGG + Intronic
942866443 2:180681290-180681312 AACAGATAGCAGGCAAAATTTGG - Intergenic
942936745 2:181566382-181566404 AACAGGCACCAGGACAAATTGGG - Intronic
943652046 2:190467672-190467694 AACAGGCAGCAGGCCAGATTTGG - Intronic
944390915 2:199218553-199218575 TTAAGACATCAGGCCAAATCTGG + Intergenic
947190888 2:227503466-227503488 AACAGGCAACAGGCCAAATTTGG - Intronic
947266561 2:228288766-228288788 AGCAGACATCATACCAACTAAGG + Intergenic
947699787 2:232223074-232223096 AACACACAACAGTCCAAATTCGG - Intronic
948228287 2:236330243-236330265 AACAGACAACAGGCCAAATTTGG - Intronic
948240706 2:236430995-236431017 AACAGGCACCAGGCCAGATTTGG - Intronic
1168781593 20:496210-496232 GGCAGACCACAGGCCAAATTTGG + Intronic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1169109799 20:3025046-3025068 AGCAGGCAGCAGGCCAGATTTGG + Intronic
1169175652 20:3510436-3510458 AGCAGACAGCAGGCCTGATTTGG + Intronic
1170187605 20:13608721-13608743 ACCAGGCATCTGGCCAGATTTGG + Intronic
1170500505 20:16971065-16971087 AGCAGAATTCAGGCCAGACTTGG - Intergenic
1170507371 20:17041322-17041344 AGAGGACTTCAGGACAAATTTGG - Intergenic
1170992191 20:21313206-21313228 AGCCATCCTCAGGCCAAATTTGG + Intronic
1174219767 20:48944833-48944855 AGCAGACAGTAGGCCAGATTTGG - Intronic
1175125449 20:56748007-56748029 AACAGACATCTGGCCAGATTTGG - Intergenic
1175760889 20:61561613-61561635 AACAGGCAGCAGGCCAGATTGGG - Intronic
1176707518 21:10126810-10126832 AGCTGACACCAGGCCCTATTTGG - Intergenic
1177070457 21:16499276-16499298 ACTAGACATCAGGCAAAATAAGG - Intergenic
1177406525 21:20674685-20674707 AACAGACAGCAGGCCAGATTTGG + Intergenic
1177925107 21:27204354-27204376 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1179196982 21:39173536-39173558 AGCAGACATCAGGCCTGGGTAGG - Intergenic
1180291464 22:10853486-10853508 AGCTGACACCAGGCCCTATTTGG - Intergenic
1180494269 22:15882908-15882930 AGCTGACACCAGGCCCTATTTGG - Intergenic
1180662950 22:17484884-17484906 AAAGGACATCAGGCCAGATTTGG + Intronic
1182130464 22:27846533-27846555 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1182429310 22:30290707-30290729 AGCAGGCCTCAGGCCTGATTGGG + Intronic
1182612662 22:31562121-31562143 AACAGAAAGCAGGCCAAATTTGG - Intronic
1182891422 22:33822095-33822117 ACCAGGCATCAGGCCAAGGTTGG - Intronic
1184342238 22:43892220-43892242 ACCAGAGATCAGGCAAGATTTGG - Intergenic
1184461689 22:44641328-44641350 AGCAGACAGCAGGACAAACAGGG + Intergenic
1184971010 22:48019803-48019825 GGCAGACATGAGGCCAAGGTGGG + Intergenic
1184988192 22:48150098-48150120 ATCAGACATCATTCCAAAGTGGG - Intergenic
949571162 3:5294553-5294575 AACAGAAATAAGGCTAAATTGGG - Intergenic
949798598 3:7878368-7878390 AGCTGAGTTCAGGCCAAAGTAGG - Intergenic
951448284 3:22807417-22807439 AGCAAAAATCAGGAAAAATTTGG - Intergenic
951703419 3:25520007-25520029 AACAGGCAGCAGGCCAGATTTGG - Intronic
952629770 3:35452840-35452862 AGCTGACTTTAGGCCAAAGTGGG - Intergenic
954946398 3:54428628-54428650 AGCAGAAATAAGGCCCATTTGGG - Intronic
955144733 3:56305767-56305789 AGCAGGCAAAAGGCCAGATTTGG - Intronic
955499603 3:59570755-59570777 AATAGACCACAGGCCAAATTTGG - Intergenic
955666991 3:61360307-61360329 ACCAGACAGCTGGCCAGATTTGG + Intergenic
956161431 3:66357471-66357493 AGCAAACATCAGGGAAAATGTGG + Intronic
956212067 3:66812302-66812324 AACAGGCAGCAGGCCAAGTTTGG + Intergenic
956732926 3:72213454-72213476 AACAGGCTGCAGGCCAAATTCGG - Intergenic
956770079 3:72518166-72518188 AACAGGCAGCAGGCCAGATTTGG + Intergenic
957846874 3:85748394-85748416 AGGAGACATAAGGACAATTTAGG - Intronic
959231858 3:103664873-103664895 ACCAGAGATGAGGGCAAATTGGG - Intergenic
959423720 3:106159458-106159480 AGCAGACTGCATGCCAGATTTGG + Intergenic
959621616 3:108404195-108404217 AGCACATAGAAGGCCAAATTTGG + Intronic
961620399 3:128219426-128219448 TGCAGACAGCAAGCCAAATGGGG - Intronic
962239554 3:133740374-133740396 AGCTGAGATCATGCCACATTAGG - Intergenic
963761138 3:149288188-149288210 AGAAGACATCAAGCAAAATCTGG - Intergenic
964968289 3:162526361-162526383 AGCAGACTACAGGCTAGATTTGG + Intergenic
965196906 3:165610541-165610563 TGAACAAATCAGGCCAAATTTGG + Intergenic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
967828145 3:193895340-193895362 GGCAGGGATCAGGCCAAACTTGG - Intergenic
970074072 4:12197352-12197374 AGCAAACCTCTGGCCAAATTAGG + Intergenic
971059937 4:22956500-22956522 AGCAGGCCACAGGCCATATTTGG + Intergenic
972586726 4:40444361-40444383 AACAAACAGCAGGCCATATTTGG - Intronic
973208558 4:47588406-47588428 ATCAGACAGTAGGCCAAATTTGG - Intronic
974021894 4:56698915-56698937 AGCAGGGATGGGGCCAAATTGGG - Intergenic
975328696 4:73089383-73089405 AACAGGCAGCAGGCCAAATTTGG + Intronic
977466261 4:97385606-97385628 AGCAAACTTCAGCTCAAATTTGG + Intronic
977903789 4:102453332-102453354 AGAAGACTTTATGCCAAATTTGG + Intergenic
981124921 4:141094621-141094643 AACAGGCCTCAGGCCAGATTTGG + Intronic
984000738 4:174239981-174240003 AGCAGGCAGCAGGCCAGATCTGG - Intronic
985380017 4:189383545-189383567 ACCAGAGAATAGGCCAAATTTGG + Intergenic
985608879 5:875275-875297 AGCAGACTTCAGGTCAGATCTGG + Intronic
985858653 5:2451318-2451340 AGCAGGCAGCTGGCCAGATTTGG + Intergenic
987607817 5:20160827-20160849 TGCAGGCTGCAGGCCAAATTAGG + Intronic
987669246 5:20985994-20986016 AACAGACAAAAGGCCAAATTTGG - Intergenic
989106608 5:37868871-37868893 AGGAGACATCTGGCAAAATCTGG - Intergenic
989437717 5:41434172-41434194 AGCAGCCAACAGGGCAAACTAGG - Intronic
990422060 5:55645456-55645478 AACAGACATCAGACAAGATTTGG - Intronic
990428091 5:55708878-55708900 ATCTGTCAGCAGGCCAAATTTGG + Intronic
990433591 5:55764248-55764270 AGATGGCAACAGGCCAAATTAGG - Intronic
990808760 5:59698125-59698147 AGAAGACTTCAGGCAAAATTAGG - Intronic
990980509 5:61598628-61598650 AGCAGGCAGCAGACCAGATTTGG - Intergenic
993213884 5:84993905-84993927 AACAAACATCAGGCCTATTTGGG - Intergenic
993608261 5:90021553-90021575 CAGAGACATGAGGCCAAATTTGG + Intergenic
994139708 5:96328511-96328533 AGCAGAAATCAAGGCAGATTCGG + Intergenic
994170834 5:96658227-96658249 TGCACACATCATCCCAAATTTGG + Intronic
994221885 5:97205761-97205783 AGCAGACATGAGGCAATGTTTGG - Intergenic
994900894 5:105767878-105767900 GACAGGCATCAGGCCAGATTTGG - Intergenic
995372516 5:111434713-111434735 AGCAGACATGACACCAAAATAGG + Intronic
996764740 5:127024472-127024494 AGAAGACATCAGGTCAAACGGGG + Intronic
996822300 5:127643722-127643744 AGGAGACATGAGGCTAAATTAGG - Intergenic
996976252 5:129438686-129438708 AGCAGGCATAAGGCCAAACAGGG - Intergenic
998790494 5:145761738-145761760 AGCAGGCAGCCGGCTAAATTTGG + Intronic
999387957 5:151168937-151168959 AGCAGACAACCAGCCAGATTCGG + Intergenic
1000950885 5:167481256-167481278 AACAGGCAGCAGGCCATATTTGG - Intronic
1000999788 5:167994776-167994798 AGCAGACATGACTCGAAATTAGG - Intronic
1001014603 5:168128694-168128716 AACAGGCAGCAGGCCAGATTTGG - Intronic
1001149588 5:169215616-169215638 AGCAGGCAGTGGGCCAAATTTGG + Intronic
1002357661 5:178643844-178643866 AACAGTCAGCAGGCCAGATTTGG - Intergenic
1003026587 6:2560300-2560322 AACAGGCTTCAGGCCAAATGTGG - Intergenic
1006718210 6:36133443-36133465 AGCAGACTTGAGGCCCCATTTGG + Intronic
1007034653 6:38662176-38662198 AGCTGAGTTCAGGCCAAAGTAGG + Intergenic
1008239687 6:49094345-49094367 AGCAGGCACCAGGCCATGTTTGG + Intergenic
1010590815 6:77709927-77709949 AGCAGAAATCAGTCCAAAGCAGG + Intronic
1010816750 6:80366872-80366894 AACAGACATCTGGCAGAATTAGG + Intergenic
1013258955 6:108418241-108418263 AACAGGCAGCAGGCCAGATTTGG - Intronic
1013485392 6:110591477-110591499 AGGAGACAGCAGGTCAAACTAGG - Intergenic
1013725453 6:113090070-113090092 AGCAAACATCAGCAAAAATTTGG - Intergenic
1014915622 6:127144590-127144612 AGAAGACATCATGCAAAATAGGG - Intronic
1016647574 6:146427504-146427526 AGCAGACATTTGAACAAATTGGG - Intronic
1017868994 6:158470191-158470213 AGCAGACACCCTGCCAGATTCGG + Intronic
1018662008 6:166097070-166097092 AACAGAAATGAGGCCAAATCTGG + Intergenic
1021664643 7:22963747-22963769 AACAGGCATCAGGCCAGACTGGG + Intronic
1023659691 7:42459343-42459365 AGCCAACCTCAGGCCACATTTGG - Intergenic
1024771302 7:52726372-52726394 AGCAAAAATAAGGCCAAATAAGG + Intergenic
1025845571 7:65193500-65193522 AGCAGGCAACAGGCCAGCTTTGG - Intergenic
1025895790 7:65699213-65699235 AGCAGGCAACAGGCCAGCTTTGG - Intergenic
1026291053 7:69006515-69006537 AACGGGCATCAGGCCAGATTTGG - Intergenic
1027737960 7:81959292-81959314 AGCAGACATCAGGCCCTTTTCGG + Exonic
1028357349 7:89925403-89925425 AACAGACAGCAGGCTGAATTTGG - Intergenic
1029917837 7:104230748-104230770 TGGAGACAGCATGCCAAATTAGG + Intergenic
1030178501 7:106679606-106679628 AGCTGACATCAGGACATATGAGG - Intergenic
1031076606 7:117219453-117219475 AGCAGACACCAGCCCAAACCAGG - Intronic
1033653878 7:143361224-143361246 AGGGGACAGCAGGCCAACTTTGG - Intronic
1033706241 7:143887405-143887427 AGAAAACATAAGGACAAATTTGG + Intronic
1035491377 7:159281787-159281809 ACCAGTCATCAGGCCAGCTTTGG + Intergenic
1036091430 8:5669793-5669815 AGCAGGCATCATGACAAATCTGG - Intergenic
1041541317 8:58988306-58988328 AGCAGACAGCAGACCAGATTTGG - Intronic
1044774197 8:95670566-95670588 AGTAAACATTAGGACAAATTGGG + Intergenic
1044881018 8:96722360-96722382 AGCAGAGAGCAGGCCAGATCTGG - Intronic
1045032675 8:98152660-98152682 AACAGACAGCAGGCCACATTTGG + Intronic
1046885945 8:119367274-119367296 AACAGTCAGCAGACCAAATTTGG + Intergenic
1047343516 8:124005399-124005421 AGCACACAGCAGGACATATTGGG - Intronic
1051406700 9:16745249-16745271 AGAAGACCACAGGCCAAGTTTGG + Intronic
1051731646 9:20149752-20149774 AACAGGCAGCAGGCCACATTTGG + Intergenic
1051784501 9:20727430-20727452 AGAAGAAATCAGGCCATTTTTGG + Intronic
1052726863 9:32239066-32239088 GTCAGACAGCTGGCCAAATTTGG - Intergenic
1053260114 9:36655383-36655405 AGAATACATCAAGCAAAATTAGG - Intronic
1053644714 9:40113547-40113569 AGCTGACACCAGGCCCTATTTGG - Intergenic
1053761270 9:41351304-41351326 AGCTGACACCAGGCCCTATTTGG + Intergenic
1054325734 9:63711427-63711449 AGCTGACACCAGGCCCTATTTGG - Intergenic
1054350045 9:64012849-64012871 AGCTGACACCAGGCCCTATTTGG + Intergenic
1054539862 9:66262422-66262444 AGCTGACACCAGGCCCTATTTGG + Intergenic
1055590483 9:77807961-77807983 AATAGGCAGCAGGCCAAATTTGG + Intronic
1056128011 9:83555387-83555409 AGCAGCAGTCTGGCCAAATTTGG + Intergenic
1056575657 9:87854356-87854378 ATCAGACTTCAGGCCAAAGCTGG - Intergenic
1060010332 9:120038134-120038156 AGCAGACAGCAGGCAGCATTTGG - Intergenic
1061760715 9:132849314-132849336 AGCAGGCAGCAGGCCAGATTTGG - Intronic
1062059125 9:134485490-134485512 AGCAGGCAGCAGGCCACATGTGG - Intergenic
1202792266 9_KI270719v1_random:95690-95712 AGCTGACACCAGGCCCTATTTGG - Intergenic
1186341882 X:8654174-8654196 GGGAGACATAAGACCAAATTTGG - Intronic
1186896322 X:14007962-14007984 AACAGACTGCAGGCCAGATTTGG - Intergenic
1187019492 X:15365482-15365504 GGCAGGCAGCAGGCTAAATTAGG - Intronic
1187729324 X:22236574-22236596 AACAGGCAGCAGGCCATATTTGG - Intronic
1188544659 X:31291188-31291210 AGCAGACTTTGGGCTAAATTTGG + Intronic
1188887386 X:35567506-35567528 AGCAAACTTCAGGCCCAGTTGGG + Intergenic
1189280601 X:39818027-39818049 AGCAGTCATCAGCCCAAAGATGG - Intergenic
1192342662 X:70277187-70277209 AACAGGCATCAGGCCAGATTTGG + Intronic
1192788483 X:74356373-74356395 AGCAGAAAACATTCCAAATTTGG + Intergenic
1192975095 X:76274574-76274596 AGCAGACATCATACTAAATTAGG - Intergenic
1198282412 X:135155045-135155067 TGCAGGCATCAGGCCAGAATTGG + Intergenic
1198287073 X:135201477-135201499 TGCAGGCATCAGGCCAGAATTGG + Intergenic
1198288547 X:135217477-135217499 TGCAGGCATCAGGCCAGAATTGG - Intergenic
1200241282 X:154495579-154495601 AGGTGGCATCAGTCCAAATTTGG + Intergenic
1200300109 X:154965646-154965668 AGCAGGCCACAAGCCAAATTTGG + Intronic
1201151015 Y:11095698-11095720 AGCTGACACCAGGCCCTATTTGG + Intergenic
1201751618 Y:17438131-17438153 AACAAACATCAGGGCAAATTGGG + Intergenic