ID: 1168784852

View in Genome Browser
Species Human (GRCh38)
Location 20:529409-529431
Sequence TGGCATATACAGCTGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168784852_1168784857 9 Left 1168784852 20:529409-529431 CCTTTGTCCAGCTGTATATGCCA 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1168784857 20:529441-529463 TAGTCACTTGGTAGCCTTCTTGG No data
1168784852_1168784855 -3 Left 1168784852 20:529409-529431 CCTTTGTCCAGCTGTATATGCCA 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1168784855 20:529429-529451 CCACCTGCTCATTAGTCACTTGG 0: 1
1: 0
2: 5
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168784852 Original CRISPR TGGCATATACAGCTGGACAA AGG (reversed) Intronic
901611790 1:10504559-10504581 TGGCAGACACAGCTGGGTAAAGG - Intronic
902497409 1:16883177-16883199 TTCATTATACAGCTGGACAATGG + Intronic
905833091 1:41090453-41090475 TGGGATATGTAGCTGGAAAAGGG + Intronic
907621356 1:55983820-55983842 TGGGATATACAAGAGGACAAGGG + Intergenic
913657757 1:120977489-120977511 TTCATTATACAGCTGGACAATGG - Intergenic
914647736 1:149669225-149669247 TTCATTATACAGCTGGACAATGG - Intergenic
915737797 1:158095542-158095564 TGGCACAGACAGGTGGAAAACGG + Exonic
917030826 1:170689568-170689590 TGGCATAGACATCTGGTCACAGG - Intronic
917632746 1:176905925-176905947 TGGTACAGACAGCTGGACATGGG + Intronic
920701872 1:208224044-208224066 TTGCACGTACAGCTGCACAAGGG - Intronic
1063764517 10:9122918-9122940 TTGCATATACAGTTGACCAATGG - Intergenic
1065598432 10:27341958-27341980 TGGTATATACAACAGGACGATGG + Intergenic
1066221038 10:33336196-33336218 TGGCACAAATAGCTGGCCAAAGG + Exonic
1066527700 10:36299094-36299116 TGTCACAAACAGCTGGACTAGGG - Intergenic
1068587675 10:58817447-58817469 TGCCCTATTCAGCTGAACAATGG + Intronic
1071845955 10:89521467-89521489 TGATATGTACAGCTGTACAAAGG + Intronic
1076158474 10:128222411-128222433 TGGCATGAACAGCTGGAAAGCGG - Intergenic
1076699572 10:132264503-132264525 TGGCACATCCTGCTGGACAGAGG + Intronic
1079149269 11:17883223-17883245 TAGAAAATACAGCTGGACCAGGG + Intronic
1079786494 11:24679803-24679825 TGGCAGATACAACTGAACTAAGG - Intronic
1080109210 11:28546618-28546640 TGGCATATAAAATTGGAGAAAGG - Intergenic
1082090574 11:48086116-48086138 TGACATGTAAAGCTGAACAAGGG + Intronic
1086931366 11:92696533-92696555 TGGTATATGCTGATGGACAATGG - Intronic
1087794321 11:102439164-102439186 GGGCATACATAGCTGAACAAAGG + Intronic
1091190674 11:133693132-133693154 AGGAATAAACAGCTGGAAAATGG - Intergenic
1091287013 11:134413049-134413071 TGGAATATACAGCTCCACAGAGG - Intergenic
1094628167 12:32146071-32146093 TGACATATACATATGAACAAAGG + Intronic
1096662560 12:53136409-53136431 TTTCATATACAGCTGGGCATGGG - Intergenic
1097242278 12:57583690-57583712 TGGCATATACAGATGGGAAGAGG - Intronic
1097908657 12:64946364-64946386 TGGCATCTACTGCTGGACTTGGG + Intergenic
1098904416 12:76147219-76147241 TGGTATAAACATCTTGACAAAGG - Intergenic
1099256749 12:80323927-80323949 TAGCATATACAACTTGAGAATGG - Intronic
1102107300 12:110336320-110336342 TGTCATACACAGCTGTATAAAGG + Intronic
1102999403 12:117374005-117374027 TGGCAAAAACACCAGGACAAGGG + Intronic
1105224118 13:18412420-18412442 TGGTATATACAACAGGACGATGG - Intergenic
1105675992 13:22672191-22672213 TGGCACGCACAGCTGGGCAATGG - Intergenic
1105821991 13:24087992-24088014 TACTAAATACAGCTGGACAAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107060894 13:36158563-36158585 TGGCAAATAATGCTGGACCACGG - Intergenic
1108041279 13:46341319-46341341 TGGCATATATAGCTGTTTAATGG - Intergenic
1108597247 13:51960136-51960158 TCTCATATATACCTGGACAAAGG + Exonic
1109305449 13:60635458-60635480 TGTCATATACTGCTGCATAAAGG + Intergenic
1113263766 13:108593918-108593940 TGGCAGACACAGCTGGCCCATGG + Intergenic
1120960153 14:90117195-90117217 CAGTGTATACAGCTGGACAAAGG + Intronic
1123873190 15:24596969-24596991 AGGCATATCCAGCTGGATGAAGG + Intergenic
1125069656 15:35537915-35537937 TGGCATATAGTGCTAGACACTGG - Intronic
1126811917 15:52415191-52415213 TGACAAATAAAGCTTGACAAAGG + Intronic
1127291012 15:57571193-57571215 TAGCATATAGAGCTGGACAAAGG + Intergenic
1128881852 15:71251213-71251235 TCTCATCTACAGCTGGAAAATGG - Intronic
1128994220 15:72285043-72285065 TGCCATATAAAGCTGATCAATGG - Exonic
1131720590 15:95164316-95164338 TGGTATGTACAGCTGGAAAATGG - Intergenic
1133525088 16:6597330-6597352 TGGCTTATCCAGATGGATAATGG - Intronic
1135484885 16:22855502-22855524 TGGCAGTTGCAGCTGGACAGGGG - Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1139668111 16:68472437-68472459 TGGGAAAGACAGCTGGACATGGG + Intergenic
1141813538 16:86393054-86393076 TGACAGATACAGATAGACAAGGG - Intergenic
1145889466 17:28404926-28404948 AGCCACATAGAGCTGGACAATGG + Exonic
1146188957 17:30748169-30748191 TAGCATATACAACTACACAAAGG - Intergenic
1146409296 17:32568522-32568544 TGACTTATACAGCTGTGCAAAGG - Intronic
1146537671 17:33667040-33667062 TGGCTTAAACAGGTGGACTATGG + Intronic
1146643108 17:34555900-34555922 TGGAGGAAACAGCTGGACAAAGG - Intergenic
1146734407 17:35225475-35225497 TGGCATATTCAACTGGAAATGGG - Intergenic
1147922888 17:43929194-43929216 TGTCATATCTTGCTGGACAAAGG - Intergenic
1151100044 17:71545853-71545875 TGGCAAATACAGCTTGACTTAGG + Intergenic
1151508339 17:74543559-74543581 TGGTGAATACAGCTGGATAAGGG + Intronic
1152239284 17:79153120-79153142 GGGCAGACACAGCTGGACCAGGG - Intronic
1153140313 18:1964645-1964667 TGGGAAAAACAGCTGGAAAAAGG + Intergenic
1155807096 18:30185024-30185046 TGGTAACTACAGCTGGACATTGG + Intergenic
1156506787 18:37600877-37600899 TGGCATACAGAGCAGGAGAAGGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1160421342 18:78748537-78748559 TGGAATATACACCTGGAACAGGG - Intergenic
1167652653 19:50741446-50741468 TGTCATATCCTGCTGGGCAAAGG + Intergenic
1168701655 19:58443494-58443516 AGGCCTCTAGAGCTGGACAAGGG - Intergenic
926173953 2:10572373-10572395 TGGCAGAAACAGCAGGACCAAGG + Intronic
926502066 2:13668052-13668074 ACGCAGATACAGATGGACAATGG + Intergenic
929620285 2:43347819-43347841 TGGCAGACACAGCTGGAGAAAGG + Intronic
930310071 2:49729327-49729349 TGTGATATACTACTGGACAATGG + Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
933677614 2:85070849-85070871 TGGGATATTCAGCAGGAAAAAGG - Intergenic
934232347 2:90195823-90195845 TGGCAGAACCAGCAGGACAATGG + Intergenic
935760722 2:106318150-106318172 TGTTAGATATAGCTGGACAATGG + Intergenic
936285989 2:111181843-111181865 TGGCTCATAGAGCTGGTCAAAGG + Intergenic
936522226 2:113218527-113218549 TGGCAACTACAGATGGTCAAAGG + Exonic
937460141 2:122078449-122078471 TGTCATATAGATCAGGACAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938204268 2:129403896-129403918 GGGCATTTCCAGCTGGACACAGG + Intergenic
944969207 2:204972675-204972697 TAGAAAATACAGCTGGAAAAAGG - Intronic
946665850 2:222049312-222049334 TGGCACTTACAGCTGGGCACAGG + Intergenic
946665858 2:222049353-222049375 TGGCACTTACAGCTGGGCACAGG + Intergenic
947394184 2:229671293-229671315 TGGCATATTCAGGTGTCCAAGGG - Intronic
948121165 2:235531551-235531573 TGCCATATCCAGTGGGACAAGGG + Intronic
948402396 2:237693073-237693095 CTGCATATTGAGCTGGACAACGG - Intronic
1168784852 20:529409-529431 TGGCATATACAGCTGGACAAAGG - Intronic
1170708135 20:18764636-18764658 TGGAATATAGAGTTGGAAAAGGG + Intergenic
1170841640 20:19928875-19928897 AGGCATGTACAGCAGGACAGAGG - Intronic
1174881161 20:54280828-54280850 TGGGAAATAAAGCTGGAAAAGGG - Intergenic
1176768209 21:13041778-13041800 TGGTATATACAACAGGACGATGG - Intergenic
1176966870 21:15220956-15220978 AGGTACATACAGTTGGACAATGG - Intergenic
1179124073 21:38576308-38576330 TGACGTCCACAGCTGGACAATGG - Intronic
1179305837 21:40153444-40153466 TGGCATACACAGCTGCACCCAGG + Intronic
1179320481 21:40286430-40286452 GGGCATACAGAGCAGGACAAAGG + Intronic
1181936802 22:26444618-26444640 TGGAATATACAGCTGGTCGCAGG + Exonic
1182778479 22:32849077-32849099 TGGCATTGTCAGATGGACAAGGG + Intronic
951016791 3:17741138-17741160 TAACATGTGCAGCTGGACAAGGG - Intronic
951233009 3:20201317-20201339 TGGCACACACAGCTGGACCATGG + Intergenic
953020281 3:39108639-39108661 TGGAAACTACAGCTTGACAAAGG - Intronic
955045188 3:55352994-55353016 TGGAGTTTACAGCTGGGCAAGGG - Intergenic
956085462 3:65604379-65604401 TAGCAAATACTGCTGGAGAAAGG + Intronic
956722760 3:72133135-72133157 TGACAGATACAGGTGGGCAAAGG - Intergenic
960571071 3:119185867-119185889 TGCCATACACAGCTGAACATGGG - Intronic
962400420 3:135054386-135054408 TGAAAAATACAGCTGGATAAAGG - Intronic
969791212 4:9495010-9495032 TGGGATATGGAGCTGGGCAAGGG - Intergenic
973239476 4:47942051-47942073 TGTTATGTACAACTGGACAATGG - Exonic
973955612 4:56060227-56060249 TGGCATGAACAGCTGGAGTAGGG - Intergenic
975529471 4:75385845-75385867 AGGCATATACAAATGGGCAATGG + Intergenic
980685761 4:136225736-136225758 TGGCATTTACAGAAGGACATGGG - Intergenic
982484542 4:155951786-155951808 TGGGATAGAGAGCTGGACAGTGG - Intronic
983365128 4:166776631-166776653 TGGCAGGTACAGCTTAACAAAGG + Intronic
984380015 4:178981004-178981026 TGGCATAGACAGCTGGAATATGG + Intergenic
984395363 4:179190907-179190929 TGGCATATGCTGCTTGACACAGG + Intergenic
985885627 5:2675526-2675548 TGGCAAAAACGGCTGGTCAAAGG - Intergenic
988284698 5:29196752-29196774 TGGCAAATAGAGCTTTACAAAGG + Intergenic
988334615 5:29890215-29890237 TGACATATGCAGCTGGATAAAGG - Intergenic
988973713 5:36494636-36494658 TGGGATATAGGGCTGGACACTGG - Intergenic
989498634 5:42139531-42139553 TGGCTTGTACAACTGGTCAAAGG + Intergenic
991158892 5:63471586-63471608 TGGCATATTGAGCAAGACAAAGG - Intergenic
992478473 5:77127058-77127080 TGGAATAGAAAGCTGGATAATGG - Intergenic
994101330 5:95896019-95896041 TGGCAGATGCAGCCAGACAATGG + Intronic
997708301 5:135979677-135979699 TAGCATACACAGTTGGACAACGG + Intergenic
998094711 5:139390692-139390714 TGGCATCTCCAGCTAGAAAATGG + Exonic
998108961 5:139486555-139486577 TGGCACCTACAGCTGGACAGGGG + Intergenic
998213820 5:140222410-140222432 TGGCAAATACAGATGGACACTGG - Intronic
998533175 5:142903949-142903971 TGGTACATAAAGCTGGACTAGGG - Intronic
998704229 5:144740267-144740289 TGGCAGATCCAGATGCACAAAGG + Intergenic
1000401647 5:160834909-160834931 AGGCATAAACATCTGGTCAAGGG - Intronic
1000456133 5:161451843-161451865 AGGCATATACAGCAAGACCAAGG + Intronic
1002106707 5:176882848-176882870 GTGCATAAACAGCTGGACAGAGG - Intronic
1002261394 5:177996018-177996040 TGGCATACACAGAGGGAGAAGGG - Exonic
1002271907 5:178078006-178078028 TAGCAGAGACAGCTGGATAAAGG - Intergenic
1005900800 6:30214707-30214729 TGAGTTATACTGCTGGACAAAGG - Intergenic
1008374826 6:50779592-50779614 GGGAATATACGGCAGGACAAAGG - Intergenic
1012756435 6:103237921-103237943 GTGCATATAAAGCTGGGCAAGGG - Intergenic
1014181408 6:118388412-118388434 TTATTTATACAGCTGGACAAAGG + Intergenic
1014657222 6:124122483-124122505 TGTCATATAAAGCTCAACAAGGG + Intronic
1014787806 6:125638264-125638286 TGGAGTATACAGTTGGATAAGGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017541000 6:155403096-155403118 TTTCATTTACATCTGGACAAAGG + Intronic
1019561525 7:1661412-1661434 TGGCACATCCAGCCGGATAAAGG - Intergenic
1022493664 7:30839681-30839703 TTGCAGATAGAGCTGGAGAAAGG + Intronic
1027567250 7:79811189-79811211 TAGCACATAAAGCTGGTCAAGGG - Intergenic
1027967261 7:85028069-85028091 TGTCATATCAAACTGGACAATGG - Intronic
1028600666 7:92597148-92597170 TGGCATATAAAGCTAGAGATTGG - Intergenic
1031408122 7:121409777-121409799 AGGCATATACAGATGTTCAAGGG + Intergenic
1034029488 7:147744418-147744440 TGGCATATAAAGTTGAATAATGG - Intronic
1034394114 7:150807190-150807212 TGTCATATAGAGCTGTTCAAAGG - Intergenic
1036767920 8:11560674-11560696 TGGCAGATCCAGGTGGACAGAGG - Intronic
1037644056 8:20774161-20774183 TGGCATATAAAGCTGTACCTCGG - Intergenic
1042135344 8:65628016-65628038 TGGCATAATCAGATGGACAGAGG - Intronic
1042375318 8:68044504-68044526 AGGCATCTACAGATGGACATCGG + Exonic
1044683303 8:94803223-94803245 TGTGATATACAGCAGGTCAATGG + Intergenic
1045554447 8:103201925-103201947 TGGCAGATAAAGGTGGAAAATGG + Intronic
1046368879 8:113273518-113273540 TAGCATATACAGCTTGGCAAAGG - Intronic
1049188385 8:141271485-141271507 GGCCACACACAGCTGGACAACGG + Intronic
1049983811 9:929701-929723 TGGCACAAACAGGGGGACAACGG - Intronic
1050778678 9:9302400-9302422 TTGCATATGCAGCTGGAGAAGGG - Intronic
1051528809 9:18077254-18077276 TGGCATTTAAAGCTACACAAAGG + Intergenic
1052957514 9:34264885-34264907 CAGCATATACAACTGGAAAAAGG + Intronic
1055242789 9:74204254-74204276 TGAAATATACATCTGGGCAATGG + Intergenic
1055891576 9:81129658-81129680 TAGAATATAAAGCTGGATAAAGG + Intergenic
1056208829 9:84345663-84345685 TGGCAGGTACAGTTGGAGAATGG - Intergenic
1056462254 9:86819087-86819109 AGGCATATGCGTCTGGACAAGGG - Intergenic
1056965778 9:91161882-91161904 TGCCATCTGCAGCTGGACTAGGG + Intergenic
1059165578 9:112073597-112073619 TAGCATACTCAGCTGGACAGTGG + Intronic
1061290044 9:129645516-129645538 TGGCATAGACAGCAGGAAGAAGG - Intergenic
1186812005 X:13199594-13199616 TCTCATATACAAATGGACAATGG + Intergenic
1196760276 X:119194639-119194661 TTGCACTTACAGCTGGACCATGG + Intergenic
1197229454 X:123987990-123988012 AGGCATATACATGTGGACAAAGG + Intronic
1198671843 X:139089590-139089612 AGGCATATAAAGCTAGTCAATGG - Intronic