ID: 1168787967

View in Genome Browser
Species Human (GRCh38)
Location 20:556298-556320
Sequence ACGTATATGGAGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168787960_1168787967 -9 Left 1168787960 20:556284-556306 CCAATGTGGTCCAGACGTATATG No data
Right 1168787967 20:556298-556320 ACGTATATGGAGAGGGTGGAGGG No data
1168787957_1168787967 15 Left 1168787957 20:556260-556282 CCTGTTAATGGCATATCAAGGAG No data
Right 1168787967 20:556298-556320 ACGTATATGGAGAGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168787967 Original CRISPR ACGTATATGGAGAGGGTGGA GGG Intergenic
No off target data available for this crispr