ID: 1168788639

View in Genome Browser
Species Human (GRCh38)
Location 20:561071-561093
Sequence TCCACATAATGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168788639_1168788642 26 Left 1168788639 20:561071-561093 CCAGCACTCCCTCATTATGTGGA No data
Right 1168788642 20:561120-561142 AGCTTCAGTTTCCCCATTGATGG No data
1168788639_1168788643 27 Left 1168788639 20:561071-561093 CCAGCACTCCCTCATTATGTGGA No data
Right 1168788643 20:561121-561143 GCTTCAGTTTCCCCATTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168788639 Original CRISPR TCCACATAATGAGGGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr