ID: 1168789028

View in Genome Browser
Species Human (GRCh38)
Location 20:563644-563666
Sequence CTCCCCTCAGTGGCTCTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168789028_1168789036 6 Left 1168789028 20:563644-563666 CCCCCTAGAGCCACTGAGGGGAG No data
Right 1168789036 20:563673-563695 AGGCATGAGGAGATGTAGCTGGG No data
1168789028_1168789038 18 Left 1168789028 20:563644-563666 CCCCCTAGAGCCACTGAGGGGAG No data
Right 1168789038 20:563685-563707 ATGTAGCTGGGGCCAAGACAAGG No data
1168789028_1168789034 -7 Left 1168789028 20:563644-563666 CCCCCTAGAGCCACTGAGGGGAG No data
Right 1168789034 20:563660-563682 AGGGGAGAGATAAAGGCATGAGG No data
1168789028_1168789037 7 Left 1168789028 20:563644-563666 CCCCCTAGAGCCACTGAGGGGAG No data
Right 1168789037 20:563674-563696 GGCATGAGGAGATGTAGCTGGGG No data
1168789028_1168789035 5 Left 1168789028 20:563644-563666 CCCCCTAGAGCCACTGAGGGGAG No data
Right 1168789035 20:563672-563694 AAGGCATGAGGAGATGTAGCTGG No data
1168789028_1168789039 21 Left 1168789028 20:563644-563666 CCCCCTAGAGCCACTGAGGGGAG No data
Right 1168789039 20:563688-563710 TAGCTGGGGCCAAGACAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168789028 Original CRISPR CTCCCCTCAGTGGCTCTAGG GGG (reversed) Intergenic
No off target data available for this crispr