ID: 1168789032

View in Genome Browser
Species Human (GRCh38)
Location 20:563653-563675
Sequence GCCACTGAGGGGAGAGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168789024_1168789032 -10 Left 1168789024 20:563640-563662 CCTTCCCCCTAGAGCCACTGAGG No data
Right 1168789032 20:563653-563675 GCCACTGAGGGGAGAGATAAAGG No data
1168789023_1168789032 -9 Left 1168789023 20:563639-563661 CCCTTCCCCCTAGAGCCACTGAG No data
Right 1168789032 20:563653-563675 GCCACTGAGGGGAGAGATAAAGG No data
1168789022_1168789032 -8 Left 1168789022 20:563638-563660 CCCCTTCCCCCTAGAGCCACTGA No data
Right 1168789032 20:563653-563675 GCCACTGAGGGGAGAGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168789032 Original CRISPR GCCACTGAGGGGAGAGATAA AGG Intergenic
No off target data available for this crispr