ID: 1168789037

View in Genome Browser
Species Human (GRCh38)
Location 20:563674-563696
Sequence GGCATGAGGAGATGTAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168789023_1168789037 12 Left 1168789023 20:563639-563661 CCCTTCCCCCTAGAGCCACTGAG No data
Right 1168789037 20:563674-563696 GGCATGAGGAGATGTAGCTGGGG No data
1168789033_1168789037 -3 Left 1168789033 20:563654-563676 CCACTGAGGGGAGAGATAAAGGC No data
Right 1168789037 20:563674-563696 GGCATGAGGAGATGTAGCTGGGG No data
1168789024_1168789037 11 Left 1168789024 20:563640-563662 CCTTCCCCCTAGAGCCACTGAGG No data
Right 1168789037 20:563674-563696 GGCATGAGGAGATGTAGCTGGGG No data
1168789029_1168789037 6 Left 1168789029 20:563645-563667 CCCCTAGAGCCACTGAGGGGAGA No data
Right 1168789037 20:563674-563696 GGCATGAGGAGATGTAGCTGGGG No data
1168789022_1168789037 13 Left 1168789022 20:563638-563660 CCCCTTCCCCCTAGAGCCACTGA No data
Right 1168789037 20:563674-563696 GGCATGAGGAGATGTAGCTGGGG No data
1168789030_1168789037 5 Left 1168789030 20:563646-563668 CCCTAGAGCCACTGAGGGGAGAG No data
Right 1168789037 20:563674-563696 GGCATGAGGAGATGTAGCTGGGG No data
1168789031_1168789037 4 Left 1168789031 20:563647-563669 CCTAGAGCCACTGAGGGGAGAGA No data
Right 1168789037 20:563674-563696 GGCATGAGGAGATGTAGCTGGGG No data
1168789028_1168789037 7 Left 1168789028 20:563644-563666 CCCCCTAGAGCCACTGAGGGGAG No data
Right 1168789037 20:563674-563696 GGCATGAGGAGATGTAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168789037 Original CRISPR GGCATGAGGAGATGTAGCTG GGG Intergenic
No off target data available for this crispr