ID: 1168789041

View in Genome Browser
Species Human (GRCh38)
Location 20:563704-563726
Sequence AAGGAGGAAGAGAAGAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168789033_1168789041 27 Left 1168789033 20:563654-563676 CCACTGAGGGGAGAGATAAAGGC No data
Right 1168789041 20:563704-563726 AAGGAGGAAGAGAAGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168789041 Original CRISPR AAGGAGGAAGAGAAGAGCTC AGG Intergenic
No off target data available for this crispr