ID: 1168790630

View in Genome Browser
Species Human (GRCh38)
Location 20:573528-573550
Sequence GGGATGCGTCCAGCCCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168790630_1168790637 21 Left 1168790630 20:573528-573550 CCAGAGGGGGCTGGACGCATCCC No data
Right 1168790637 20:573572-573594 CGATTTTCTCATCTGTGAGGTGG No data
1168790630_1168790636 18 Left 1168790630 20:573528-573550 CCAGAGGGGGCTGGACGCATCCC No data
Right 1168790636 20:573569-573591 TCTCGATTTTCTCATCTGTGAGG No data
1168790630_1168790638 22 Left 1168790630 20:573528-573550 CCAGAGGGGGCTGGACGCATCCC No data
Right 1168790638 20:573573-573595 GATTTTCTCATCTGTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168790630 Original CRISPR GGGATGCGTCCAGCCCCCTC TGG (reversed) Intergenic
No off target data available for this crispr